ID: 1152033689

View in Genome Browser
Species Human (GRCh38)
Location 17:77858802-77858824
Sequence GAGAGTGACACACAAATACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152033681_1152033689 2 Left 1152033681 17:77858777-77858799 CCTGATGGCACTCACCCCCAGTG No data
Right 1152033689 17:77858802-77858824 GAGAGTGACACACAAATACACGG No data
1152033680_1152033689 7 Left 1152033680 17:77858772-77858794 CCTTTCCTGATGGCACTCACCCC No data
Right 1152033689 17:77858802-77858824 GAGAGTGACACACAAATACACGG No data
1152033678_1152033689 21 Left 1152033678 17:77858758-77858780 CCATGGGTATGAATCCTTTCCTG No data
Right 1152033689 17:77858802-77858824 GAGAGTGACACACAAATACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152033689 Original CRISPR GAGAGTGACACACAAATACA CGG Intergenic
No off target data available for this crispr