ID: 1152034746

View in Genome Browser
Species Human (GRCh38)
Location 17:77865212-77865234
Sequence GTGCGCCCGCGCGTGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152034746_1152034749 29 Left 1152034746 17:77865212-77865234 CCCACGCACACGCGCGGGCGCAC No data
Right 1152034749 17:77865264-77865286 CACACATATCTGAACAGGCCAGG No data
1152034746_1152034748 24 Left 1152034746 17:77865212-77865234 CCCACGCACACGCGCGGGCGCAC No data
Right 1152034748 17:77865259-77865281 ACACACACACATATCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152034746 Original CRISPR GTGCGCCCGCGCGTGTGCGT GGG (reversed) Intergenic