ID: 1152038470

View in Genome Browser
Species Human (GRCh38)
Location 17:77888065-77888087
Sequence GTGTGCGCGCACCCGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152038470_1152038484 27 Left 1152038470 17:77888065-77888087 CCCATGCACGGGTGCGCGCACAC No data
Right 1152038484 17:77888115-77888137 CCCAAAGGGACTCGAATGAAAGG No data
1152038470_1152038477 13 Left 1152038470 17:77888065-77888087 CCCATGCACGGGTGCGCGCACAC No data
Right 1152038477 17:77888101-77888123 CTCCCTCCTGCTCCCCCAAAGGG No data
1152038470_1152038476 12 Left 1152038470 17:77888065-77888087 CCCATGCACGGGTGCGCGCACAC No data
Right 1152038476 17:77888100-77888122 CCTCCCTCCTGCTCCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152038470 Original CRISPR GTGTGCGCGCACCCGTGCAT GGG (reversed) Intergenic
No off target data available for this crispr