ID: 1152040165

View in Genome Browser
Species Human (GRCh38)
Location 17:77897818-77897840
Sequence GCCCCTGCTCTGACAAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152040165_1152040171 29 Left 1152040165 17:77897818-77897840 CCTCCCTTTGTCAGAGCAGGGGC No data
Right 1152040171 17:77897870-77897892 ACCCACCTCTGCTAGATCCTGGG No data
1152040165_1152040170 28 Left 1152040165 17:77897818-77897840 CCTCCCTTTGTCAGAGCAGGGGC No data
Right 1152040170 17:77897869-77897891 GACCCACCTCTGCTAGATCCTGG No data
1152040165_1152040168 6 Left 1152040165 17:77897818-77897840 CCTCCCTTTGTCAGAGCAGGGGC No data
Right 1152040168 17:77897847-77897869 ATGCTGCTACTGACTGATCCAGG No data
1152040165_1152040173 30 Left 1152040165 17:77897818-77897840 CCTCCCTTTGTCAGAGCAGGGGC No data
Right 1152040173 17:77897871-77897893 CCCACCTCTGCTAGATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152040165 Original CRISPR GCCCCTGCTCTGACAAAGGG AGG (reversed) Intergenic
No off target data available for this crispr