ID: 1152041328

View in Genome Browser
Species Human (GRCh38)
Location 17:77905839-77905861
Sequence CTGTGTGAGCAGCTAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152041328_1152041332 4 Left 1152041328 17:77905839-77905861 CCGTCCACTAGCTGCTCACACAG No data
Right 1152041332 17:77905866-77905888 AGCCCTGCAGCCCTGACTGGAGG No data
1152041328_1152041331 1 Left 1152041328 17:77905839-77905861 CCGTCCACTAGCTGCTCACACAG No data
Right 1152041331 17:77905863-77905885 TGCAGCCCTGCAGCCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152041328 Original CRISPR CTGTGTGAGCAGCTAGTGGA CGG (reversed) Intergenic
No off target data available for this crispr