ID: 1152042745

View in Genome Browser
Species Human (GRCh38)
Location 17:77915072-77915094
Sequence CAGAGAAAAGGGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152042745_1152042753 13 Left 1152042745 17:77915072-77915094 CCATCCTCCTGCCCTTTTCTCTG No data
Right 1152042753 17:77915108-77915130 TCCACTCCACTCTCCAAATCAGG No data
1152042745_1152042755 17 Left 1152042745 17:77915072-77915094 CCATCCTCCTGCCCTTTTCTCTG No data
Right 1152042755 17:77915112-77915134 CTCCACTCTCCAAATCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152042745 Original CRISPR CAGAGAAAAGGGCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr