ID: 1152044719

View in Genome Browser
Species Human (GRCh38)
Location 17:77928421-77928443
Sequence CTGAATGAAGAAAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152044716_1152044719 13 Left 1152044716 17:77928385-77928407 CCACTTGGGGAGAGAAACAACAA No data
Right 1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152044719 Original CRISPR CTGAATGAAGAAAAGGAAGC AGG Intergenic
No off target data available for this crispr