ID: 1152048501

View in Genome Browser
Species Human (GRCh38)
Location 17:77954821-77954843
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048501_1152048508 7 Left 1152048501 17:77954821-77954843 CCAATATTATTATCAGCATAGTG No data
Right 1152048508 17:77954851-77954873 AAAGGCATCAGAATCACTTGGGG No data
1152048501_1152048507 6 Left 1152048501 17:77954821-77954843 CCAATATTATTATCAGCATAGTG No data
Right 1152048507 17:77954850-77954872 CAAAGGCATCAGAATCACTTGGG No data
1152048501_1152048506 5 Left 1152048501 17:77954821-77954843 CCAATATTATTATCAGCATAGTG No data
Right 1152048506 17:77954849-77954871 ACAAAGGCATCAGAATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048501 Original CRISPR CACTATGCTGATAATAATAT TGG (reversed) Intergenic
No off target data available for this crispr