ID: 1152048506

View in Genome Browser
Species Human (GRCh38)
Location 17:77954849-77954871
Sequence ACAAAGGCATCAGAATCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048501_1152048506 5 Left 1152048501 17:77954821-77954843 CCAATATTATTATCAGCATAGTG No data
Right 1152048506 17:77954849-77954871 ACAAAGGCATCAGAATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048506 Original CRISPR ACAAAGGCATCAGAATCACT TGG Intergenic
No off target data available for this crispr