ID: 1152048938

View in Genome Browser
Species Human (GRCh38)
Location 17:77958219-77958241
Sequence GCGCGTCCGGTGGGTTCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048938_1152048949 18 Left 1152048938 17:77958219-77958241 CCCGGAGAACCCACCGGACGCGC No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048938_1152048944 -10 Left 1152048938 17:77958219-77958241 CCCGGAGAACCCACCGGACGCGC No data
Right 1152048944 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048938 Original CRISPR GCGCGTCCGGTGGGTTCTCC GGG (reversed) Intergenic
No off target data available for this crispr