ID: 1152048939

View in Genome Browser
Species Human (GRCh38)
Location 17:77958220-77958242
Sequence TGCGCGTCCGGTGGGTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048939_1152048949 17 Left 1152048939 17:77958220-77958242 CCGGAGAACCCACCGGACGCGCA No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048939 Original CRISPR TGCGCGTCCGGTGGGTTCTC CGG (reversed) Intergenic
No off target data available for this crispr