ID: 1152048941

View in Genome Browser
Species Human (GRCh38)
Location 17:77958228-77958250
Sequence TCCGGTTCTGCGCGTCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048941_1152048956 26 Left 1152048941 17:77958228-77958250 CCCACCGGACGCGCAGAACCGGA No data
Right 1152048956 17:77958277-77958299 ACGCGGAGCCACAGCGCCCAGGG No data
1152048941_1152048955 25 Left 1152048941 17:77958228-77958250 CCCACCGGACGCGCAGAACCGGA No data
Right 1152048955 17:77958276-77958298 AACGCGGAGCCACAGCGCCCAGG No data
1152048941_1152048949 9 Left 1152048941 17:77958228-77958250 CCCACCGGACGCGCAGAACCGGA No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048941 Original CRISPR TCCGGTTCTGCGCGTCCGGT GGG (reversed) Intergenic
No off target data available for this crispr