ID: 1152048942

View in Genome Browser
Species Human (GRCh38)
Location 17:77958229-77958251
Sequence ATCCGGTTCTGCGCGTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048942_1152048949 8 Left 1152048942 17:77958229-77958251 CCACCGGACGCGCAGAACCGGAT No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048942_1152048955 24 Left 1152048942 17:77958229-77958251 CCACCGGACGCGCAGAACCGGAT No data
Right 1152048955 17:77958276-77958298 AACGCGGAGCCACAGCGCCCAGG No data
1152048942_1152048956 25 Left 1152048942 17:77958229-77958251 CCACCGGACGCGCAGAACCGGAT No data
Right 1152048956 17:77958277-77958299 ACGCGGAGCCACAGCGCCCAGGG No data
1152048942_1152048957 30 Left 1152048942 17:77958229-77958251 CCACCGGACGCGCAGAACCGGAT No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048942 Original CRISPR ATCCGGTTCTGCGCGTCCGG TGG (reversed) Intergenic
No off target data available for this crispr