ID: 1152048943

View in Genome Browser
Species Human (GRCh38)
Location 17:77958232-77958254
Sequence CCGATCCGGTTCTGCGCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048943_1152048955 21 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048955 17:77958276-77958298 AACGCGGAGCCACAGCGCCCAGG No data
1152048943_1152048956 22 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048956 17:77958277-77958299 ACGCGGAGCCACAGCGCCCAGGG No data
1152048943_1152048957 27 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048943_1152048949 5 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048943_1152048959 30 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048959 17:77958285-77958307 CCACAGCGCCCAGGGACCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048943 Original CRISPR CCGATCCGGTTCTGCGCGTC CGG (reversed) Intergenic
No off target data available for this crispr