ID: 1152048944

View in Genome Browser
Species Human (GRCh38)
Location 17:77958232-77958254
Sequence CCGGACGCGCAGAACCGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048938_1152048944 -10 Left 1152048938 17:77958219-77958241 CCCGGAGAACCCACCGGACGCGC No data
Right 1152048944 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
1152048933_1152048944 12 Left 1152048933 17:77958197-77958219 CCCGGGCGCCGCGGGGCGCTGGC No data
Right 1152048944 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
1152048934_1152048944 11 Left 1152048934 17:77958198-77958220 CCGGGCGCCGCGGGGCGCTGGCC No data
Right 1152048944 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
1152048936_1152048944 4 Left 1152048936 17:77958205-77958227 CCGCGGGGCGCTGGCCCGGAGAA No data
Right 1152048944 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048944 Original CRISPR CCGGACGCGCAGAACCGGAT CGG Intergenic
No off target data available for this crispr