ID: 1152048945

View in Genome Browser
Species Human (GRCh38)
Location 17:77958246-77958268
Sequence TGGCGGGAGGGGTGCCGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048945_1152048955 7 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048955 17:77958276-77958298 AACGCGGAGCCACAGCGCCCAGG No data
1152048945_1152048963 24 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048963 17:77958293-77958315 CCCAGGGACCGGAGGGCAGGCGG No data
1152048945_1152048965 27 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048965 17:77958296-77958318 AGGGACCGGAGGGCAGGCGGCGG No data
1152048945_1152048966 30 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048966 17:77958299-77958321 GACCGGAGGGCAGGCGGCGGCGG No data
1152048945_1152048957 13 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048945_1152048956 8 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048956 17:77958277-77958299 ACGCGGAGCCACAGCGCCCAGGG No data
1152048945_1152048949 -9 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048945_1152048959 16 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048959 17:77958285-77958307 CCACAGCGCCCAGGGACCGGAGG No data
1152048945_1152048960 17 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048945_1152048961 21 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048961 17:77958290-77958312 GCGCCCAGGGACCGGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048945 Original CRISPR TGGCGGGAGGGGTGCCGATC CGG (reversed) Intergenic
No off target data available for this crispr