ID: 1152048949

View in Genome Browser
Species Human (GRCh38)
Location 17:77958260-77958282
Sequence CTCCCGCCAGCACCCTAACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048942_1152048949 8 Left 1152048942 17:77958229-77958251 CCACCGGACGCGCAGAACCGGAT No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048939_1152048949 17 Left 1152048939 17:77958220-77958242 CCGGAGAACCCACCGGACGCGCA No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048943_1152048949 5 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048938_1152048949 18 Left 1152048938 17:77958219-77958241 CCCGGAGAACCCACCGGACGCGC No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048941_1152048949 9 Left 1152048941 17:77958228-77958250 CCCACCGGACGCGCAGAACCGGA No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data
1152048945_1152048949 -9 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048949 17:77958260-77958282 CTCCCGCCAGCACCCTAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048949 Original CRISPR CTCCCGCCAGCACCCTAACG CGG Intergenic
No off target data available for this crispr