ID: 1152048952

View in Genome Browser
Species Human (GRCh38)
Location 17:77958266-77958288
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048952_1152048959 -4 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048959 17:77958285-77958307 CCACAGCGCCCAGGGACCGGAGG No data
1152048952_1152048966 10 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048966 17:77958299-77958321 GACCGGAGGGCAGGCGGCGGCGG No data
1152048952_1152048965 7 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048965 17:77958296-77958318 AGGGACCGGAGGGCAGGCGGCGG No data
1152048952_1152048961 1 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048961 17:77958290-77958312 GCGCCCAGGGACCGGAGGGCAGG No data
1152048952_1152048968 16 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048952_1152048960 -3 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048952_1152048957 -7 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048952_1152048963 4 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048963 17:77958293-77958315 CCCAGGGACCGGAGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048952 Original CRISPR GTGGCTCCGCGTTAGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr