ID: 1152048957

View in Genome Browser
Species Human (GRCh38)
Location 17:77958282-77958304
Sequence GAGCCACAGCGCCCAGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048950_1152048957 -3 Left 1152048950 17:77958262-77958284 CCCGCCAGCACCCTAACGCGGAG No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048945_1152048957 13 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048951_1152048957 -4 Left 1152048951 17:77958263-77958285 CCGCCAGCACCCTAACGCGGAGC No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048952_1152048957 -7 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048946_1152048957 2 Left 1152048946 17:77958257-77958279 CCCCTCCCGCCAGCACCCTAACG No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048942_1152048957 30 Left 1152048942 17:77958229-77958251 CCACCGGACGCGCAGAACCGGAT No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048943_1152048957 27 Left 1152048943 17:77958232-77958254 CCGGACGCGCAGAACCGGATCGG No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048947_1152048957 1 Left 1152048947 17:77958258-77958280 CCCTCCCGCCAGCACCCTAACGC No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data
1152048948_1152048957 0 Left 1152048948 17:77958259-77958281 CCTCCCGCCAGCACCCTAACGCG No data
Right 1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048957 Original CRISPR GAGCCACAGCGCCCAGGGAC CGG Intergenic
No off target data available for this crispr