ID: 1152048960

View in Genome Browser
Species Human (GRCh38)
Location 17:77958286-77958308
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048954_1152048960 -10 Left 1152048954 17:77958273-77958295 CCTAACGCGGAGCCACAGCGCCC No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048947_1152048960 5 Left 1152048947 17:77958258-77958280 CCCTCCCGCCAGCACCCTAACGC No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048952_1152048960 -3 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048953_1152048960 -9 Left 1152048953 17:77958272-77958294 CCCTAACGCGGAGCCACAGCGCC No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048948_1152048960 4 Left 1152048948 17:77958259-77958281 CCTCCCGCCAGCACCCTAACGCG No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048945_1152048960 17 Left 1152048945 17:77958246-77958268 CCGGATCGGCACCCCTCCCGCCA No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048951_1152048960 0 Left 1152048951 17:77958263-77958285 CCGCCAGCACCCTAACGCGGAGC No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048950_1152048960 1 Left 1152048950 17:77958262-77958284 CCCGCCAGCACCCTAACGCGGAG No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data
1152048946_1152048960 6 Left 1152048946 17:77958257-77958279 CCCCTCCCGCCAGCACCCTAACG No data
Right 1152048960 17:77958286-77958308 CACAGCGCCCAGGGACCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048960 Original CRISPR CACAGCGCCCAGGGACCGGA GGG Intergenic
No off target data available for this crispr