ID: 1152048968

View in Genome Browser
Species Human (GRCh38)
Location 17:77958305-77958327
Sequence AGGGCAGGCGGCGGCGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152048946_1152048968 25 Left 1152048946 17:77958257-77958279 CCCCTCCCGCCAGCACCCTAACG No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048950_1152048968 20 Left 1152048950 17:77958262-77958284 CCCGCCAGCACCCTAACGCGGAG No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048951_1152048968 19 Left 1152048951 17:77958263-77958285 CCGCCAGCACCCTAACGCGGAGC No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048947_1152048968 24 Left 1152048947 17:77958258-77958280 CCCTCCCGCCAGCACCCTAACGC No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048958_1152048968 -3 Left 1152048958 17:77958285-77958307 CCACAGCGCCCAGGGACCGGAGG No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048948_1152048968 23 Left 1152048948 17:77958259-77958281 CCTCCCGCCAGCACCCTAACGCG No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048953_1152048968 10 Left 1152048953 17:77958272-77958294 CCCTAACGCGGAGCCACAGCGCC No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048954_1152048968 9 Left 1152048954 17:77958273-77958295 CCTAACGCGGAGCCACAGCGCCC No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data
1152048952_1152048968 16 Left 1152048952 17:77958266-77958288 CCAGCACCCTAACGCGGAGCCAC No data
Right 1152048968 17:77958305-77958327 AGGGCAGGCGGCGGCGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152048968 Original CRISPR AGGGCAGGCGGCGGCGGTAA AGG Intergenic
No off target data available for this crispr