ID: 1152049084

View in Genome Browser
Species Human (GRCh38)
Location 17:77958760-77958782
Sequence GGAGCCGTAGCCGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049075_1152049084 15 Left 1152049075 17:77958722-77958744 CCGCGGTGGCAGCTCCGCACCTC No data
Right 1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG No data
1152049080_1152049084 -4 Left 1152049080 17:77958741-77958763 CCTCAGCGCGACGGCCCCGGGAG No data
Right 1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG No data
1152049077_1152049084 1 Left 1152049077 17:77958736-77958758 CCGCACCTCAGCGCGACGGCCCC No data
Right 1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049084 Original CRISPR GGAGCCGTAGCCGCCGCCGC CGG Intergenic
No off target data available for this crispr