ID: 1152049178

View in Genome Browser
Species Human (GRCh38)
Location 17:77959066-77959088
Sequence CGGCGCGGGCGAGTGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049178_1152049189 9 Left 1152049178 17:77959066-77959088 CCGCCGCCCACTCGCCCGCGCCG No data
Right 1152049189 17:77959098-77959120 CCGCCGCCGCCGCCCGCGCCGGG No data
1152049178_1152049195 23 Left 1152049178 17:77959066-77959088 CCGCCGCCCACTCGCCCGCGCCG No data
Right 1152049195 17:77959112-77959134 CGCGCCGGGACCTGAGTCCGTGG No data
1152049178_1152049187 8 Left 1152049178 17:77959066-77959088 CCGCCGCCCACTCGCCCGCGCCG No data
Right 1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG No data
1152049178_1152049197 29 Left 1152049178 17:77959066-77959088 CCGCCGCCCACTCGCCCGCGCCG No data
Right 1152049197 17:77959118-77959140 GGGACCTGAGTCCGTGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049178 Original CRISPR CGGCGCGGGCGAGTGGGCGG CGG (reversed) Intergenic