ID: 1152049225

View in Genome Browser
Species Human (GRCh38)
Location 17:77959215-77959237
Sequence CCGCGGGGCTCCGGTGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049225_1152049240 9 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049225_1152049236 1 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049225_1152049235 -3 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049225_1152049234 -4 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049234 17:77959234-77959256 GCGGAGCCGCCGCCGCCGCCGGG No data
1152049225_1152049233 -5 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049233 17:77959233-77959255 CGCGGAGCCGCCGCCGCCGCCGG No data
1152049225_1152049243 18 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049225 Original CRISPR CCGCGGGGCTCCGGTGGCGC GGG (reversed) Intergenic