ID: 1152049235

View in Genome Browser
Species Human (GRCh38)
Location 17:77959235-77959257
Sequence CGGAGCCGCCGCCGCCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049220_1152049235 11 Left 1152049220 17:77959201-77959223 CCGCCGCCGCCAGGCCCGCGCCA No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049224_1152049235 2 Left 1152049224 17:77959210-77959232 CCAGGCCCGCGCCACCGGAGCCC No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049219_1152049235 14 Left 1152049219 17:77959198-77959220 CCGCCGCCGCCGCCAGGCCCGCG No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049223_1152049235 5 Left 1152049223 17:77959207-77959229 CCGCCAGGCCCGCGCCACCGGAG No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049225_1152049235 -3 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049227_1152049235 -4 Left 1152049227 17:77959216-77959238 CCGCGCCACCGGAGCCCCGCGGA No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049221_1152049235 8 Left 1152049221 17:77959204-77959226 CCGCCGCCAGGCCCGCGCCACCG No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data
1152049228_1152049235 -9 Left 1152049228 17:77959221-77959243 CCACCGGAGCCCCGCGGAGCCGC No data
Right 1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049235 Original CRISPR CGGAGCCGCCGCCGCCGCCG GGG Intergenic