ID: 1152049236

View in Genome Browser
Species Human (GRCh38)
Location 17:77959239-77959261
Sequence GCCGCCGCCGCCGCCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049227_1152049236 0 Left 1152049227 17:77959216-77959238 CCGCGCCACCGGAGCCCCGCGGA No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049223_1152049236 9 Left 1152049223 17:77959207-77959229 CCGCCAGGCCCGCGCCACCGGAG No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049220_1152049236 15 Left 1152049220 17:77959201-77959223 CCGCCGCCGCCAGGCCCGCGCCA No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049225_1152049236 1 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049228_1152049236 -5 Left 1152049228 17:77959221-77959243 CCACCGGAGCCCCGCGGAGCCGC No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049221_1152049236 12 Left 1152049221 17:77959204-77959226 CCGCCGCCAGGCCCGCGCCACCG No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049224_1152049236 6 Left 1152049224 17:77959210-77959232 CCAGGCCCGCGCCACCGGAGCCC No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049219_1152049236 18 Left 1152049219 17:77959198-77959220 CCGCCGCCGCCGCCAGGCCCGCG No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data
1152049229_1152049236 -8 Left 1152049229 17:77959224-77959246 CCGGAGCCCCGCGGAGCCGCCGC No data
Right 1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049236 Original CRISPR GCCGCCGCCGCCGCCGGGGA CGG Intergenic