ID: 1152049240

View in Genome Browser
Species Human (GRCh38)
Location 17:77959247-77959269
Sequence CGCCGCCGGGGACGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049229_1152049240 0 Left 1152049229 17:77959224-77959246 CCGGAGCCCCGCGGAGCCGCCGC No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049231_1152049240 -7 Left 1152049231 17:77959231-77959253 CCCGCGGAGCCGCCGCCGCCGCC No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049219_1152049240 26 Left 1152049219 17:77959198-77959220 CCGCCGCCGCCGCCAGGCCCGCG No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049220_1152049240 23 Left 1152049220 17:77959201-77959223 CCGCCGCCGCCAGGCCCGCGCCA No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049228_1152049240 3 Left 1152049228 17:77959221-77959243 CCACCGGAGCCCCGCGGAGCCGC No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049221_1152049240 20 Left 1152049221 17:77959204-77959226 CCGCCGCCAGGCCCGCGCCACCG No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049230_1152049240 -6 Left 1152049230 17:77959230-77959252 CCCCGCGGAGCCGCCGCCGCCGC No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049224_1152049240 14 Left 1152049224 17:77959210-77959232 CCAGGCCCGCGCCACCGGAGCCC No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049232_1152049240 -8 Left 1152049232 17:77959232-77959254 CCGCGGAGCCGCCGCCGCCGCCG No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049223_1152049240 17 Left 1152049223 17:77959207-77959229 CCGCCAGGCCCGCGCCACCGGAG No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049227_1152049240 8 Left 1152049227 17:77959216-77959238 CCGCGCCACCGGAGCCCCGCGGA No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data
1152049225_1152049240 9 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049240 Original CRISPR CGCCGCCGGGGACGGAGCCC AGG Intergenic