ID: 1152049243

View in Genome Browser
Species Human (GRCh38)
Location 17:77959256-77959278
Sequence GGACGGAGCCCAGGTGAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049238_1152049243 -10 Left 1152049238 17:77959243-77959265 CCGCCGCCGCCGGGGACGGAGCC No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049224_1152049243 23 Left 1152049224 17:77959210-77959232 CCAGGCCCGCGCCACCGGAGCCC No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049232_1152049243 1 Left 1152049232 17:77959232-77959254 CCGCGGAGCCGCCGCCGCCGCCG No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049230_1152049243 3 Left 1152049230 17:77959230-77959252 CCCCGCGGAGCCGCCGCCGCCGC No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049225_1152049243 18 Left 1152049225 17:77959215-77959237 CCCGCGCCACCGGAGCCCCGCGG No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049223_1152049243 26 Left 1152049223 17:77959207-77959229 CCGCCAGGCCCGCGCCACCGGAG No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049237_1152049243 -7 Left 1152049237 17:77959240-77959262 CCGCCGCCGCCGCCGGGGACGGA No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049227_1152049243 17 Left 1152049227 17:77959216-77959238 CCGCGCCACCGGAGCCCCGCGGA No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049229_1152049243 9 Left 1152049229 17:77959224-77959246 CCGGAGCCCCGCGGAGCCGCCGC No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049231_1152049243 2 Left 1152049231 17:77959231-77959253 CCCGCGGAGCCGCCGCCGCCGCC No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049221_1152049243 29 Left 1152049221 17:77959204-77959226 CCGCCGCCAGGCCCGCGCCACCG No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data
1152049228_1152049243 12 Left 1152049228 17:77959221-77959243 CCACCGGAGCCCCGCGGAGCCGC No data
Right 1152049243 17:77959256-77959278 GGACGGAGCCCAGGTGAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049243 Original CRISPR GGACGGAGCCCAGGTGAGCG CGG Intergenic