ID: 1152049492

View in Genome Browser
Species Human (GRCh38)
Location 17:77960762-77960784
Sequence TCCCCCAACAAAGCATCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152049492_1152049496 22 Left 1152049492 17:77960762-77960784 CCCTAGGATGCTTTGTTGGGGGA No data
Right 1152049496 17:77960807-77960829 AAAATGACTAGTTCAGTTGTCGG No data
1152049492_1152049495 -6 Left 1152049492 17:77960762-77960784 CCCTAGGATGCTTTGTTGGGGGA No data
Right 1152049495 17:77960779-77960801 GGGGGAAATAATGCAAAACAGGG No data
1152049492_1152049494 -7 Left 1152049492 17:77960762-77960784 CCCTAGGATGCTTTGTTGGGGGA No data
Right 1152049494 17:77960778-77960800 TGGGGGAAATAATGCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152049492 Original CRISPR TCCCCCAACAAAGCATCCTA GGG (reversed) Intergenic
No off target data available for this crispr