ID: 1152053967

View in Genome Browser
Species Human (GRCh38)
Location 17:78007198-78007220
Sequence AGTATTTTAGAGGATATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152053967_1152053973 27 Left 1152053967 17:78007198-78007220 CCTTCTATATCCTCTAAAATACT 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1152053973 17:78007248-78007270 CTACTAACTAGCCTTAGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1152053967_1152053972 26 Left 1152053967 17:78007198-78007220 CCTTCTATATCCTCTAAAATACT 0: 1
1: 0
2: 1
3: 20
4: 256
Right 1152053972 17:78007247-78007269 ACTACTAACTAGCCTTAGAATGG 0: 1
1: 0
2: 1
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152053967 Original CRISPR AGTATTTTAGAGGATATAGA AGG (reversed) Intronic
906429192 1:45740900-45740922 AGACTTTTAAAGTATATAGAAGG - Exonic
907970428 1:59375591-59375613 AGTACTTCAGAGGTTATAGAGGG + Intronic
909919056 1:81357415-81357437 ATGACTTTAGTGGATATAGAGGG - Intronic
910120495 1:83783756-83783778 AATATTTTAGAAGATAATGAGGG + Intergenic
910842594 1:91574716-91574738 AGTTTTTTAGATGACAAAGATGG + Intergenic
912986668 1:114440103-114440125 AGTCTTTTTGAGGTGATAGAGGG - Intronic
913181564 1:116327471-116327493 AGTATGTTACAGGATATTTATGG - Intergenic
915002837 1:152609175-152609197 AGTATCTTAGAAGATCAAGAGGG - Intergenic
915816523 1:158972830-158972852 AGTATTATAAAGGAAATAAATGG - Intronic
916369642 1:164076353-164076375 ATTATTTAAGAGTATATTGAGGG - Intergenic
917005466 1:170411492-170411514 AGTATTCTAGAGAATATAGAAGG - Intergenic
917078626 1:171233895-171233917 AGAATATGAGAGCATATAGATGG - Intergenic
918101664 1:181381683-181381705 AGTATTGTACAGCATATAAAGGG - Intergenic
918557043 1:185815003-185815025 AATAATTTAGGGGTTATAGAGGG + Intronic
918726133 1:187926599-187926621 ATAATTTTAGAGGATATAAGTGG - Intergenic
921255598 1:213336401-213336423 AGTCTTCTAGGTGATATAGAGGG - Intergenic
924938179 1:248789952-248789974 AGTAGTTTACAGGTCATAGATGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1068442436 10:57075714-57075736 AGTATTTCAAAAGATAAAGAGGG - Intergenic
1069388446 10:67906650-67906672 AGCATTTTAAAGTATCTAGATGG - Intronic
1072098526 10:92206525-92206547 AGTATTTGAGAGGATGTGGTAGG - Intronic
1072337639 10:94413017-94413039 AGTATTTCAGTGGTTATAGTCGG - Intronic
1072533617 10:96342804-96342826 AGAATCATAGAGGGTATAGAAGG + Intergenic
1073147999 10:101292882-101292904 TTTATATTAGAGGATATTGATGG + Intergenic
1077458616 11:2696720-2696742 ACTCTATTGGAGGATATAGAGGG - Intronic
1078532887 11:12150645-12150667 ATTAGTCTGGAGGATATAGAGGG - Intronic
1079488125 11:20956913-20956935 AGCATTTTAGATGAACTAGAAGG - Intronic
1079616731 11:22503595-22503617 AGCATTTTAGAGGCTAAAAATGG + Intergenic
1081029629 11:38062384-38062406 AGTATTTTGGAGCATAATGAAGG + Intergenic
1082177128 11:49073689-49073711 AGTATTTTTGAGGGATTAGATGG - Intergenic
1082868300 11:57919746-57919768 ACTCTTCTAGAGGATACAGAGGG + Intergenic
1085817662 11:79757586-79757608 AGCATTTTAGAGGTGCTAGATGG + Intergenic
1086140099 11:83488766-83488788 ATTATTTTAGAGGAGAAACAAGG - Intronic
1086174927 11:83879954-83879976 AGTATTTTAAAGGATGGTGAAGG + Intronic
1086670559 11:89541105-89541127 AGAATTTAAGAGGATTTTGAGGG - Intergenic
1086688577 11:89762147-89762169 AGTATTTTTGAGGGATTAGATGG + Intergenic
1086717280 11:90077801-90077823 AGTATTTTTGAGGGATTAGATGG - Intergenic
1090510739 11:127372069-127372091 AGTTTCTTAGAAGACATAGAGGG - Intergenic
1091045027 11:132317787-132317809 AGTGTCTTAGAGGATGTGGAAGG + Intronic
1092005399 12:5065135-5065157 AGTATTTTATAGTTTTTAGAAGG - Intergenic
1097649288 12:62275907-62275929 ATAATTATTGAGGATATAGAAGG + Intronic
1098573893 12:72019077-72019099 AATTTTTTAGAGGATATACTTGG + Intronic
1098726040 12:73968743-73968765 ACTATTTTAGAGGATAATTATGG - Intergenic
1099987889 12:89689252-89689274 AGTATTGTATAGGACATACATGG - Intronic
1100393176 12:94162111-94162133 AGTATTTTGAAGGAAATAAATGG + Intronic
1100997628 12:100319952-100319974 AATATTTAAGAGGCTACAGATGG + Intronic
1103661220 12:122519546-122519568 TGTCTTTTAGAGGATGTAGCAGG - Intronic
1107147950 13:37079769-37079791 AGCATTTGAGAGGATGTACAAGG + Intergenic
1107689459 13:42937914-42937936 AGATTTTTAAAGGCTATAGATGG - Intronic
1108910612 13:55546433-55546455 AGTATTTTGGAGTATATGTAGGG + Intergenic
1110594139 13:77300124-77300146 AGCATTTTAGAGGATTTACAAGG - Intronic
1111291210 13:86172219-86172241 AGTATTTGAGAAGATATGAAAGG + Intergenic
1111424572 13:88063047-88063069 AGATTTTTGGAGGAGATAGAAGG - Intergenic
1111552823 13:89838080-89838102 AGTACTTTAAAGGAAATAGTTGG - Intergenic
1112074765 13:95899656-95899678 AGCATTTTAAGGGATAAAGAGGG - Intronic
1112194234 13:97209135-97209157 AATATTTTAAAGGAAATATAGGG - Intergenic
1115209200 14:30947918-30947940 AGTATTTAAGAGGCTAATGAAGG + Intronic
1120335637 14:83150872-83150894 AGTATTTTAGAAGATAATAATGG - Intergenic
1121165483 14:91792257-91792279 AGAATATTAGAGGATCTGGAAGG - Intronic
1121339356 14:93095995-93096017 ATTATTTTACAGGAGGTAGAAGG - Intronic
1123885798 15:24726982-24727004 GGTATTTCAGAGGATATTTATGG - Intergenic
1124541770 15:30592590-30592612 TGTATTTTAGAGACTCTAGAGGG + Intergenic
1124548426 15:30654385-30654407 TGTATTTTAGAGACTCTAGAGGG + Intronic
1124756836 15:32414707-32414729 TGTATTTTAGAGACTCTAGAGGG - Intergenic
1129900284 15:79143000-79143022 AGAATTTTAAAGGAGTTAGATGG + Intergenic
1130345688 15:83042784-83042806 AGTATCTTAGATGATATACATGG + Intronic
1131915684 15:97263372-97263394 TGTATTTTAAAGGATATATGTGG + Intergenic
1132122219 15:99185911-99185933 TGTATTTTACAGGAAATAAAAGG + Intronic
1133172973 16:3993077-3993099 AGTTTATGAGAGAATATAGACGG - Intronic
1133584923 16:7183893-7183915 AGTAGTTTAAAGGGGATAGATGG + Intronic
1133666742 16:7975506-7975528 AGTATTATAAATTATATAGATGG - Intergenic
1135714669 16:24752221-24752243 ATTTGTTTAAAGGATATAGAGGG + Intronic
1135924443 16:26680184-26680206 AGTATCTTATCTGATATAGATGG + Intergenic
1137845606 16:51684816-51684838 AATATTTTAGATGACAAAGATGG - Intergenic
1138269654 16:55686016-55686038 ACTATTAAAGAGGATATGGATGG + Intronic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1139086908 16:63598200-63598222 AAAATTTTAAAAGATATAGATGG - Intergenic
1139677316 16:68533005-68533027 ATTGTTTTGGAGGATAAAGAGGG - Intronic
1140289762 16:73642261-73642283 AGTCTTTGAGAGGATACAGATGG + Intergenic
1143940758 17:10538722-10538744 GGCATTGCAGAGGATATAGAAGG - Intronic
1143942849 17:10560756-10560778 AGTACTAAAGAGGATAAAGAGGG - Intergenic
1145297771 17:21606826-21606848 TCTACTTTAGAGAATATAGAGGG + Intergenic
1145352487 17:22096593-22096615 TCTACTTTAGAGAATATAGAGGG - Intergenic
1149317085 17:55448721-55448743 AGTATTCCAGAGGATATGGTCGG + Intergenic
1151117094 17:71749230-71749252 AGTATTTTGGAATAGATAGAGGG - Intergenic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1152501528 17:80713698-80713720 AGTATTATTGATGATAAAGAGGG + Intronic
1153240506 18:3027322-3027344 AACATTTTAGAAGCTATAGAGGG + Intergenic
1153813333 18:8771157-8771179 ATTATTTTATATGATAGAGATGG + Intronic
1155061858 18:22235856-22235878 AGGATTTTGGAGGATGGAGATGG + Intergenic
1155242909 18:23880320-23880342 AGTATTTCAGAGCATGTGGAGGG - Intronic
1157142928 18:45129132-45129154 AGTATTTTAGAAAATATATTTGG + Intergenic
1157923405 18:51737256-51737278 AGTACTTTAGAGGACATTGAGGG - Intergenic
1158087351 18:53667839-53667861 ATTATTTTTAAGGAAATAGATGG - Intergenic
1160106186 18:75979201-75979223 TGAATTTTAGAGGATATTGTGGG - Intergenic
1160345994 18:78132380-78132402 AGTATTCTATAGGTTATATAAGG + Intergenic
1163812931 19:19445318-19445340 AGTATTTTAGTAGCTCTAGAGGG + Intronic
1164555018 19:29244717-29244739 AGTAATTTAGCAGATATAAAAGG - Intergenic
1165680202 19:37767707-37767729 ACTTATTTAGAGGATATAGAGGG + Intronic
1166359265 19:42245887-42245909 AGGATCTCAGAGGATATGGATGG + Intronic
1168488498 19:56786511-56786533 ATTATTTTGGAGGAAATACATGG + Intronic
926330330 2:11820043-11820065 AGTATTCTAGAGAATGTAGTTGG + Intronic
927047374 2:19293116-19293138 AGTATTTTAGAGGATAAAAGAGG + Intergenic
927080077 2:19618333-19618355 AATATGTTACAGGATATGGATGG + Intergenic
928064587 2:28150572-28150594 AGTATTTTAGTGGCTCTTGAAGG + Intronic
928734005 2:34264599-34264621 ACTATTTTACAAGATAAAGAGGG + Intergenic
928898940 2:36297201-36297223 AGGATTTTAGAGGATGAACAAGG - Intergenic
930251498 2:49039723-49039745 AATATTTTAGAGGAAACTGATGG - Intronic
930334694 2:50030076-50030098 AGAATTTTGGAGGAGAAAGAGGG + Intronic
932064917 2:68545116-68545138 AGATTTTTAGTGGATATAGCAGG - Intronic
932871192 2:75400072-75400094 AGTAGTTTTGGGGATATAGGTGG - Intergenic
933398205 2:81758401-81758423 ATTATTTCAGAAGATAAAGAGGG + Intergenic
935616066 2:105083201-105083223 AATGTTAAAGAGGATATAGATGG + Intronic
935789814 2:106580651-106580673 AGTATTTTAAAGAAAAAAGATGG - Intergenic
936234381 2:110731036-110731058 ACTATTTTGGCTGATATAGAAGG + Intergenic
936459062 2:112698084-112698106 AGGATTTCAGAGGACAGAGAAGG - Intergenic
937055814 2:118935739-118935761 AATATTGTAGAGGAGATTGAAGG + Intergenic
938131887 2:128723572-128723594 AGTATTTTACAGGAAATGAAAGG + Intergenic
939585304 2:143996987-143997009 AGTATTTTAGGGGATGAAGTTGG + Intronic
939799877 2:146696214-146696236 AATATTTTAGAGGATATTTTAGG + Intergenic
940072999 2:149710543-149710565 AATATTTAAGTGGATATAGGTGG - Intergenic
940092838 2:149940748-149940770 AGTTTTTTAGAAGATAAATATGG + Intergenic
940219350 2:151335410-151335432 AGTGCTTTAAAGTATATAGAAGG + Intergenic
940413807 2:153397041-153397063 CGTATTTTAGAGGATGAAAATGG - Intergenic
940474099 2:154138342-154138364 AGAATGTAAGAGGATAAAGAAGG + Intronic
940822447 2:158372142-158372164 AACAGTTTGGAGGATATAGAGGG - Intronic
941482999 2:166041300-166041322 AGTATTTAAGACAATACAGATGG + Exonic
941636647 2:167941993-167942015 AGCTTTTTAGAGGCTACAGATGG + Intergenic
942937918 2:181580791-181580813 ACTATTTTAGAGGATAGAAAAGG - Intronic
943444244 2:187963812-187963834 ATTATTAGAGAGGACATAGAAGG - Intergenic
945486220 2:210399170-210399192 TGTATTTTAAAAGGTATAGAGGG + Intergenic
945728601 2:213504543-213504565 AATATATTAGAAGATAAAGAAGG + Intronic
947139166 2:227005045-227005067 AGTATTTTAAAGGATCAAAAGGG - Exonic
948497930 2:238366256-238366278 AATATTTTAAATGATATAGCTGG - Intronic
1169152661 20:3302506-3302528 AGTATTTTAGGGGATGGGGAGGG - Intronic
1169629419 20:7611528-7611550 AGTATTTTAAAAGAAATATATGG - Intergenic
1170676840 20:18490036-18490058 GGTATTTTAGAATATCTAGAAGG - Intronic
1173054317 20:39596623-39596645 AGTATTTTAGAGAACAGAAAGGG + Intergenic
1174879634 20:54264939-54264961 AGTAATTTAAAGGATATGGGAGG + Intergenic
1175027329 20:55915982-55916004 AGTAGTTTTGGGGATACAGATGG - Intergenic
1175615735 20:60396722-60396744 AGTAGATTAGAGAACATAGAAGG + Intergenic
1176345219 21:5737560-5737582 ATTAATTCTGAGGATATAGAAGG - Intergenic
1176352033 21:5858144-5858166 ATTAATTCTGAGGATATAGAAGG - Intergenic
1176499608 21:7586895-7586917 ATTAATTCTGAGGATATAGAAGG + Intergenic
1176539540 21:8135630-8135652 ATTAATTCTGAGGATATAGAAGG - Intergenic
1176558491 21:8318675-8318697 ATTAATTCTGAGGATATAGAAGG - Intergenic
1176937731 21:14885916-14885938 TATATTTTTGATGATATAGACGG + Intergenic
1177229531 21:18301895-18301917 ATTATTTTTGAGGTCATAGATGG + Intronic
1177308525 21:19353929-19353951 AGTATTATTGAGGATAAATACGG + Intergenic
1177776209 21:25569677-25569699 AGTAATTTAGAGGAAAGATAAGG - Intergenic
1177827482 21:26100630-26100652 TGTATTTTAGAGGAGAAAGTTGG + Intronic
1179264832 21:39794149-39794171 AGAATTTTAGAGGAGAGAGGAGG + Intronic
949468602 3:4369830-4369852 ACTAGTTTATAGGATTTAGAGGG + Intronic
949477441 3:4462102-4462124 AGTATTTTACAAGAAGTAGAGGG - Intronic
951090133 3:18562683-18562705 ATGATTTTAGGGGATACAGAGGG + Intergenic
951279879 3:20735234-20735256 GGTATTTTGGGGGATGTAGATGG + Intergenic
951575723 3:24111781-24111803 TGGATTTTAGAGGATAAAGTAGG + Intergenic
951737647 3:25885457-25885479 ATTATTTTATAATATATAGAGGG + Intergenic
952265406 3:31780920-31780942 AGTATTGCAGAAGATAAAGAGGG + Intronic
952474710 3:33695828-33695850 AGCATTATATAGCATATAGAAGG - Intronic
952573768 3:34748961-34748983 AGTATCCTAGAGGATACATATGG + Intergenic
953311855 3:41888283-41888305 TGTATTTTAGAGACTCTAGAGGG - Intronic
955046281 3:55363415-55363437 AGCATTTCAGAGGAAATAGAAGG - Intergenic
955822342 3:62909446-62909468 AGAATTTTAAAAGATATATAAGG + Intergenic
956235788 3:67069416-67069438 AGTATTTTAGAGGGCATGTAGGG + Intergenic
956905527 3:73761312-73761334 TTTAATTTAGAGGATTTAGAAGG - Intergenic
958444760 3:94202138-94202160 AATATGTTATAGGATATGGATGG - Intergenic
962545549 3:136430862-136430884 AGTATGTGAGTGGATATAAAAGG - Intronic
963602523 3:147390652-147390674 ATTATTTTAGAAGATAAATATGG - Intronic
963752184 3:149193430-149193452 AGTTTTTTTAATGATATAGAAGG + Intronic
963957213 3:151267598-151267620 ATTATTTTATAGGATTTAGGTGG - Intronic
964867485 3:161277060-161277082 AAAATTTTACAGGATATGGATGG + Intergenic
965607372 3:170510477-170510499 AATATTTTGGAGGTTATTGAAGG + Intronic
970544907 4:17117849-17117871 AAAATTATTGAGGATATAGAGGG + Intergenic
971032743 4:22658686-22658708 TGTATTTTAGGGGATAAAGGTGG - Intergenic
971524234 4:27595991-27596013 TGTATTTTAGATCATATTGAAGG + Intergenic
971896299 4:32600671-32600693 AGTATTCAAGAGGATAAAAAGGG - Intergenic
972101616 4:35426920-35426942 AGTATTTTTGAAAATATAAAGGG - Intergenic
972102480 4:35439321-35439343 TGTATTTTATAGGAAAGAGAGGG - Intergenic
973895830 4:55411989-55412011 ATTATTTTAGAGGATACACAAGG - Intronic
974986806 4:69037463-69037485 TGTATTTTACAGGACATAGATGG - Intronic
975423072 4:74191876-74191898 AGGATGTTAGAGGATATGGAAGG + Intronic
975464081 4:74689540-74689562 AGTCTTTTAAAGAATAAAGAAGG - Intergenic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
976685196 4:87806638-87806660 AATATTGTAGAGGAGATATACGG - Intronic
978220338 4:106265249-106265271 AATTTTTTTGAGGATATAGCAGG + Intronic
979486227 4:121273951-121273973 AATATTTTACAGGAAATAAAGGG - Intergenic
980046358 4:127993125-127993147 AGTATGCTAAAGGATATAGAAGG + Intronic
980255844 4:130380297-130380319 AGCATTTAAAAGGATATATATGG - Intergenic
980479003 4:133360529-133360551 AGCATTTGAAAGGATAGAGAAGG - Intergenic
980491737 4:133536367-133536389 ATTATTTTATAGTATATAAATGG + Intergenic
980547184 4:134280796-134280818 AGCATTTTGCAGGATAAAGACGG - Intergenic
980659299 4:135835809-135835831 ATTATTTTAGAGCATCAAGAAGG - Intergenic
980879366 4:138693940-138693962 AGTATTTTGGAGGGTAAAGAGGG + Intergenic
983699123 4:170569787-170569809 AATATTTTAGCTGATATAGCAGG - Intergenic
988966350 5:36422256-36422278 AGTCTTGTAGAGGATATTCATGG + Intergenic
990016905 5:51074109-51074131 AATATTTTAGATTATCTAGAGGG - Intergenic
992115568 5:73535717-73535739 AGTATTGTAGAAGACAGAGAAGG + Intergenic
993064859 5:83085166-83085188 AGAATTTTATTGGATAAAGAAGG + Intronic
993893880 5:93506948-93506970 AGACATTTAGATGATATAGATGG - Intergenic
993940794 5:94056514-94056536 TGTATTTTATAGGTTATTGAAGG - Intronic
994058420 5:95446332-95446354 TGTATTTTAGGGTATGTAGAGGG + Intronic
994319845 5:98381306-98381328 ATTATATTAGAGGTTATAGATGG + Intergenic
994904009 5:105813081-105813103 AGGATTTTAAAGAATATAGAAGG - Intergenic
995928515 5:117406487-117406509 TCTATTTTAGAGGATATAAAGGG + Intergenic
997896898 5:137727007-137727029 TGTAATTTAGAGGATAGAGGAGG - Intronic
999084984 5:148880014-148880036 AACATTTTTGAGGATAAAGATGG - Intergenic
1000576438 5:162980983-162981005 AAGCTCTTAGAGGATATAGATGG + Intergenic
1000634194 5:163625064-163625086 AGTTTTTTAGATGATCTTGAGGG + Intergenic
1005152988 6:22774094-22774116 TGTATTTTAGAGTTCATAGAAGG - Intergenic
1008138041 6:47799863-47799885 AGAAATTTAGAGGATGTACATGG - Intronic
1009202434 6:60762283-60762305 ACTATTTTAAAAGTTATAGAGGG + Intergenic
1009903883 6:69844473-69844495 GGTATTATAGAGGATATTAATGG + Intergenic
1010285165 6:74068634-74068656 AGTATTATAAAGCATATACACGG - Intergenic
1013323516 6:109020645-109020667 AGGTTTTCAGAGGATTTAGAAGG + Intronic
1014910115 6:127081879-127081901 AGTTTTTTTGAGGATGAAGAGGG + Intergenic
1016704086 6:147086788-147086810 AGTGTTAGTGAGGATATAGAGGG + Intergenic
1017342314 6:153338535-153338557 CATATTTTAGAGTATACAGAAGG + Intergenic
1017463549 6:154673609-154673631 TGTCTTGTAGAGGGTATAGATGG - Intergenic
1018641807 6:165910661-165910683 AGGATTTTATAGTATATTGAGGG - Intronic
1020064797 7:5179523-5179545 AGAATATTAGAAGAAATAGAGGG - Intergenic
1021245477 7:18256392-18256414 TGGATTTTAGAGGAGCTAGATGG + Intronic
1021719460 7:23491571-23491593 AGTCTTGTGGAGGATAGAGATGG + Intergenic
1023522773 7:41065415-41065437 GGTATTTCAGAGGATAAAAAGGG + Intergenic
1023649937 7:42359114-42359136 AGTGTTTTGGAGTATATATATGG + Intergenic
1024525925 7:50349459-50349481 AGGATTTTAGAAGAGATGGATGG + Intronic
1027935934 7:84602701-84602723 AGGATTTTAGAAGACAAAGATGG + Intergenic
1028227640 7:88267438-88267460 AGTATCTTAAAAGATATAGGTGG + Intergenic
1030652528 7:112130965-112130987 AGTATTTTAGACAATAAATAGGG + Intronic
1032184406 7:129711591-129711613 AGTATTTAAGAAGATGCAGATGG - Intronic
1032880883 7:136089179-136089201 AGTATTTTAGGGCAAATAAAAGG + Intergenic
1034141201 7:148818884-148818906 ATTTTTTTAGTGGAAATAGAAGG + Intronic
1037940682 8:22948745-22948767 AGTATTTCTGAGGATAAAAATGG - Intronic
1038953762 8:32445185-32445207 AGTATTCAGGAGGATATACAAGG - Intronic
1039675553 8:39661704-39661726 AATATTTCACAGCATATAGAGGG - Intronic
1040722438 8:50342298-50342320 AGTATTTTATAAGCTAAAGAGGG - Intronic
1043528089 8:81118412-81118434 AGTATTTTGAAGGACAGAGATGG - Intergenic
1043833940 8:85023721-85023743 AGTTTCTTAGAGGACAGAGACGG + Intergenic
1044425532 8:92045713-92045735 AGTGTAGTAGGGGATATAGAAGG - Intronic
1046117759 8:109804609-109804631 AATAGTTAAGAAGATATAGAGGG - Intergenic
1046932126 8:119852245-119852267 ATTATTTTGGAGAATATTGATGG - Intronic
1048744885 8:137603239-137603261 AGCATTTGAAAGGAGATAGAAGG + Intergenic
1050178308 9:2892748-2892770 TGTAGTTAAGAGGATAAAGATGG - Intergenic
1050669095 9:7976264-7976286 AGTGCCTTAGAGGATATGGAGGG - Intergenic
1050783315 9:9367323-9367345 AGTATTTTACAGTAAATAAAAGG + Intronic
1050905443 9:10997833-10997855 AGTATTTTAGAGTACATAAGTGG + Intergenic
1051303604 9:15681956-15681978 AGTATTTTACAGACTATGGATGG + Intronic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052494375 9:29209482-29209504 AATATTTTAAAGGAAAAAGAGGG + Intergenic
1053538419 9:38948734-38948756 AGTAATGTACAGGATGTAGAGGG + Intergenic
1054627719 9:67415185-67415207 AGTAATGTACAGGATGTAGAGGG - Intergenic
1057243323 9:93432319-93432341 AAAATTTTAGATGACATAGACGG - Intergenic
1057374068 9:94502732-94502754 AATATTTTAGAGTCTATAGTAGG + Intergenic
1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG + Intergenic
1058384924 9:104424395-104424417 AGTATTTTAGATGATACCTAGGG - Intergenic
1058524275 9:105841204-105841226 AGTATTTTGGAGTTTATAGTAGG - Intergenic
1059765492 9:117380057-117380079 AGGATGTGAGAGGATATAGCAGG + Intronic
1203460824 Un_GL000220v1:35070-35092 ATTAATTCTGAGGATATAGAAGG - Intergenic
1186048112 X:5558256-5558278 AGTACTTTAGAGGACATTGTAGG + Intergenic
1186381584 X:9066375-9066397 AGTAGATTAGAGGATATTAAAGG + Intronic
1186753503 X:12646038-12646060 ATTATTTTAGAGGATAGATAAGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187511140 X:19920413-19920435 AACATTTTAGAGCATATGGATGG + Intronic
1187664853 X:21595400-21595422 AGTATTTCAGAGTATGTAGAAGG + Intronic
1187687790 X:21833011-21833033 ATTATTTTGCAGGAAATAGAAGG - Intergenic
1187766661 X:22650040-22650062 AGGCTTTTAGAGGAAATAAATGG + Intergenic
1187831271 X:23384080-23384102 AGAATGTTAGATGATGTAGAAGG + Intronic
1188098814 X:26056822-26056844 TGTATTTTAGTAGATAGAGATGG - Intergenic
1188144023 X:26587262-26587284 AGTACTTTAAAGAATATAGTGGG - Intergenic
1188350295 X:29121844-29121866 AGTAATTGACTGGATATAGAAGG - Intronic
1189153887 X:38735467-38735489 AGTATTATATATTATATAGATGG - Intergenic
1190146781 X:47899630-47899652 AGTATTTCAGAAAATAGAGAAGG - Intronic
1190619865 X:52276017-52276039 AATATGTTAGGAGATATAGAAGG - Intergenic
1195616823 X:106919218-106919240 TGTATTGTAGAAGATATCGATGG - Intronic
1196810318 X:119623920-119623942 AGTCTAGTAGAGGAGATAGAAGG + Intronic
1197698939 X:129582199-129582221 AGAATTTTAAAGGGTAGAGATGG - Intronic
1201424508 Y:13833478-13833500 AGAAATTATGAGGATATAGATGG - Intergenic
1201753025 Y:17454935-17454957 AGAATTTTAAAGGATCTAGCTGG + Intergenic