ID: 1152057357

View in Genome Browser
Species Human (GRCh38)
Location 17:78040524-78040546
Sequence TAGAATATTACAGCTAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152057356_1152057357 0 Left 1152057356 17:78040501-78040523 CCAGTTTACATATGGGGCTCATT 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1152057357 17:78040524-78040546 TAGAATATTACAGCTAGTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152057357 Original CRISPR TAGAATATTACAGCTAGTGT TGG Intronic
901793846 1:11669018-11669040 GAGAATATTCCAGGTAGTGTGGG - Intronic
902156858 1:14494626-14494648 TAGACTATTACACCTAATGTTGG - Intergenic
904129417 1:28264512-28264534 TCCAAAATAACAGCTAGTGTGGG - Intronic
912641686 1:111352194-111352216 TTGATTATTTCAGCTAGTGCTGG - Exonic
915846266 1:159268740-159268762 TAGAATATAAGACCTATTGTTGG + Intergenic
916785363 1:168083308-168083330 TATAATAGCCCAGCTAGTGTGGG + Exonic
918397410 1:184128631-184128653 AAGATTATTACAGCTATTCTAGG + Intergenic
919051061 1:192511939-192511961 TGGAATAATACAGCTATTCTAGG - Intergenic
922347203 1:224706203-224706225 TAGAATATTAGGGCTAGGGTGGG + Intronic
922401581 1:225263493-225263515 TAGAATATTAGATGTAGTGCAGG - Intronic
1064800710 10:19067663-19067685 TAAAATTTTACAGCTAGGGAGGG - Intronic
1064993466 10:21276441-21276463 TAGAAGATTATAGGAAGTGTGGG - Intergenic
1066600585 10:37102007-37102029 TAGATTCTTACAGGTAGTGTTGG + Intergenic
1067205656 10:44209859-44209881 CAGAATGTTAAACCTAGTGTGGG - Intergenic
1069085027 10:64129060-64129082 TAAAATATTGTAGCTATTGTTGG + Intergenic
1072012805 10:91318756-91318778 TAAAAAATTACAGCTAGATTGGG + Intergenic
1072992649 10:100212224-100212246 TAAATTATTACAGCTATTGTGGG - Intronic
1073278850 10:102336795-102336817 TAGGATATTACAGCTAAAATAGG - Intronic
1073885186 10:108030811-108030833 TAAAATAGTACAGCTTCTGTGGG + Intergenic
1073895592 10:108152691-108152713 TGGAAAATTGCAGCTGGTGTTGG + Intergenic
1073965171 10:108980551-108980573 TTTAATATTACATCTAGTTTTGG - Intergenic
1081258842 11:40932928-40932950 TAGAATATTTGATCTAGTGAAGG + Intronic
1083069299 11:59960455-59960477 TAAAATAATACAGCCACTGTGGG + Intergenic
1085216877 11:74840718-74840740 TAGAATGTTACAGCTGGAATGGG + Exonic
1085578846 11:77632226-77632248 TAAAATAATACAGCTTTTGTAGG - Intronic
1085889797 11:80564914-80564936 TAGATTCTTATAGATAGTGTTGG - Intergenic
1087733851 11:101809605-101809627 TAGAAAGTTAAAGCTGGTGTAGG + Intronic
1088789612 11:113212808-113212830 GAGAATATTACAACTCGTATTGG - Intronic
1091264619 11:134261062-134261084 TCGAAGATCACAGCTCGTGTTGG - Exonic
1098929521 12:76394797-76394819 TAGATTATTACAGATAATATTGG - Intronic
1099819432 12:87691579-87691601 TAGAATATGAGAGCCATTGTTGG - Intergenic
1100331647 12:93588226-93588248 TAGCATATTACAGTTGTTGTAGG + Intergenic
1101005708 12:100399132-100399154 TAAATTCTTACAGCTAGTGAGGG + Intronic
1104955403 12:132462579-132462601 TAGAATATTACTAGCAGTGTTGG - Intergenic
1105845299 13:24288926-24288948 TTGAATAGTACAGCTTTTGTAGG - Intronic
1106052031 13:26200364-26200386 CAGAATATTAAACCAAGTGTGGG - Intronic
1107223980 13:38023988-38024010 TAGAATATTAAAGATATTCTTGG - Intergenic
1110213203 13:72996887-72996909 TAGGATAATACAGCTACAGTGGG - Intronic
1110689695 13:78417860-78417882 TAGCATATTACAGTTTTTGTTGG + Intergenic
1111713656 13:91849859-91849881 TGGAATATTAGAGCTATTATGGG + Intronic
1111774449 13:92641682-92641704 TACAATATAAAAGCTACTGTAGG - Intronic
1112202171 13:97287607-97287629 TAGAAAATTACAGCTAGATCGGG - Intronic
1116146962 14:41086324-41086346 TAGAATATCATAGATAGTGGAGG - Intergenic
1118034821 14:61855422-61855444 GAGCATATTAAAGGTAGTGTAGG - Intergenic
1120656857 14:87200740-87200762 AATTATATAACAGCTAGTGTTGG - Intergenic
1124829658 15:33135781-33135803 TAGAATAGAACAGTTAGTATTGG - Intronic
1126318549 15:47397014-47397036 CAGAACATTACAACAAGTGTGGG + Intronic
1137337065 16:47560043-47560065 TAGCATATCACTGCTAGTGAAGG - Intronic
1139096789 16:63714336-63714358 TAGTATAATACAGCTGGTGAAGG + Intergenic
1140078200 16:71721702-71721724 TAGGAAGTTACAGCTAATGTCGG - Intronic
1140093114 16:71853131-71853153 TAGAATCTTAGAGCTGGTGGTGG - Exonic
1145771701 17:27498005-27498027 TAAAATATTACTGCTACTGAAGG - Intronic
1149007262 17:51819124-51819146 TAGAAAATCACTGCTAGTTTAGG + Intronic
1152057357 17:78040524-78040546 TAGAATATTACAGCTAGTGTTGG + Intronic
1203171579 17_GL000205v2_random:153378-153400 TAGAGTATTAATGCTAGTGGTGG + Intergenic
1155687408 18:28572382-28572404 TACAAGATTATAGCCAGTGTAGG + Intergenic
1164867677 19:31618400-31618422 AAGTACATTACAGATAGTGTGGG + Intergenic
1165531117 19:36402551-36402573 TAGAACATTACAAACAGTGTAGG + Intronic
1166906497 19:46113667-46113689 TGGAATATTATTGCTAGTCTTGG - Intergenic
926187288 2:10700901-10700923 TAGAATGTTAAACCAAGTGTGGG - Intergenic
926471349 2:13262461-13262483 TAAAATATTAATGCAAGTGTTGG - Intergenic
929533971 2:42769007-42769029 TTGCATTTTAAAGCTAGTGTAGG - Intronic
929940700 2:46331810-46331832 TAGAAGATTAGAGTGAGTGTAGG - Intronic
930932252 2:56900993-56901015 TATAATTTTACAGATAGTTTTGG + Intergenic
931883904 2:66594733-66594755 TAAAATATTAGAGCAAGTGGAGG - Intergenic
935404245 2:102691457-102691479 TAGAATATAACATCCAATGTTGG + Intronic
936738816 2:115478961-115478983 TAAAATATTATAGCTGCTGTGGG + Intronic
937016867 2:118613971-118613993 TAGACTATTACTGCTAGCTTGGG - Intergenic
940381511 2:153019743-153019765 TAGAATATTATAGCTCATATTGG + Intergenic
941103102 2:161320575-161320597 AAGAAAATTACACCTAGTATAGG - Intronic
941528055 2:166630530-166630552 TAGAATAGTATAGCCAGTGGGGG - Intergenic
943849574 2:192700621-192700643 TAAAATATCACTGCTAGTGGTGG - Intergenic
944049212 2:195447958-195447980 TAGAATATTTCAGTTAGATTTGG + Intergenic
947026462 2:225743259-225743281 TAAAATATTAAACCAAGTGTAGG + Intergenic
1169312764 20:4560873-4560895 TAAAATAATACAGCTGCTGTGGG - Intergenic
1173317961 20:41961850-41961872 CAGACTAATACAGCTAGGGTGGG + Intergenic
1175956216 20:62610757-62610779 TAGAATATGACAGAGAGTCTGGG + Intergenic
1176940577 21:14919446-14919468 TAAAATATTACAACGATTGTGGG - Intergenic
1178430175 21:32512019-32512041 TATAATATTATAGGTAGTGTTGG - Intronic
1182215375 22:28712731-28712753 TAGACTATTATAACTATTGTGGG + Intronic
1184852945 22:47131186-47131208 TGGAATGTGACAGCTGGTGTTGG - Intronic
949143875 3:671313-671335 TAAAATATTACAGCAACTATGGG + Intergenic
957110717 3:75953199-75953221 CAGAATAGTACAGCTACTTTGGG - Intronic
959593466 3:108103880-108103902 TAGAATATTAGAGCTAGAAGGGG - Intergenic
960222496 3:115130723-115130745 TAAAATATTATGGCTAGTTTTGG - Intronic
961532890 3:127550647-127550669 TAGAATGCTACAGTTTGTGTGGG + Intergenic
967099058 3:186200964-186200986 TAGAATATTGCAGCTGGGGGTGG + Intronic
967681673 3:192370920-192370942 TAGAATATTAATGAAAGTGTGGG + Intronic
968855714 4:3120169-3120191 TATAATATTAAAGATAGGGTTGG + Intronic
969210296 4:5682132-5682154 TAAAATATTACTGCTATTGGTGG + Intronic
970382983 4:15526744-15526766 TTGATTACTACAGCTACTGTGGG - Intronic
971516579 4:27494498-27494520 TAGAGTATAGCAGCTAATGTGGG + Intergenic
973153737 4:46922138-46922160 TAGAATACTAAGGCTAATGTGGG + Exonic
974487991 4:62528214-62528236 TATAATATTGCAGCTATTTTTGG + Intergenic
974569901 4:63631058-63631080 TAAAATATTACTCCTTGTGTTGG + Intergenic
975536597 4:75458042-75458064 TAGAACATGCCAGATAGTGTTGG - Intergenic
975808951 4:78145126-78145148 TAAAAGATTACACCTAATGTTGG - Intronic
976840530 4:89427286-89427308 TATAATATAAAAGCAAGTGTAGG + Intergenic
977213684 4:94252183-94252205 TAGAATATTGAAGATAGTATTGG + Intronic
981106488 4:140887518-140887540 TAGAATATTACAGAAACAGTGGG - Intronic
981849399 4:149210985-149211007 AAGAATCTTACAGCTGGGGTTGG + Intergenic
982442246 4:155450697-155450719 TTGACGCTTACAGCTAGTGTTGG - Intergenic
982703986 4:158687464-158687486 GAGAATATTTAAGCTAGTGCTGG - Intronic
982769990 4:159389015-159389037 TAGAAAGTAACAGGTAGTGTGGG - Intergenic
983148607 4:164247805-164247827 TAGAACATTCCATCTAGTATGGG + Intronic
986204994 5:5615147-5615169 TGGAATATTACAGCTAATTGTGG - Intergenic
988193771 5:27973797-27973819 TAGAATATTCCAGCTAGAGATGG + Intergenic
992179146 5:74179818-74179840 TAGAATACTCCAGAGAGTGTGGG + Intergenic
993577163 5:89616181-89616203 GAGAATATAACAGATAGTGTAGG - Intergenic
994977382 5:106827591-106827613 TAGAATATTACAAATGGCGTGGG - Intergenic
995380920 5:111532340-111532362 TAAAAAATTATAGCTAGTGTTGG - Intergenic
997688145 5:135803773-135803795 TAGAATATTACATATAATATCGG - Intergenic
998581162 5:143377448-143377470 GAGAATGGTAGAGCTAGTGTGGG - Intronic
1003375538 6:5573516-5573538 TAGAGTCTTAGAGCTAGTGCGGG + Intronic
1003689119 6:8335372-8335394 TAGATCATTACATCTAGAGTTGG - Intergenic
1003750011 6:9044458-9044480 TAGAATTCTAGAGCTACTGTAGG + Intergenic
1003965606 6:11249647-11249669 TAGAGGATGACTGCTAGTGTTGG + Intronic
1004226717 6:13791767-13791789 TAAAATATTTCAGAAAGTGTTGG + Intronic
1005468317 6:26137018-26137040 TAGAATATAAAAGCTGGGGTCGG - Intronic
1006220828 6:32489548-32489570 TAGAATATTACAGATAGAATAGG + Intergenic
1007055817 6:38883464-38883486 TATAATATTACAGCAAATGATGG - Intronic
1007716318 6:43858248-43858270 TAGAACATTAAACCAAGTGTGGG + Intergenic
1008057002 6:46955614-46955636 TAGAACATTAAAGCAAGTGTGGG + Intergenic
1008609839 6:53175671-53175693 TAGAATATTAAAGTTAGAGTTGG - Intergenic
1012826680 6:104154856-104154878 AAGAATATAAGAGCTACTGTAGG - Intergenic
1013945210 6:115714917-115714939 TAGAATATGACAGGTACTATGGG + Intergenic
1014684296 6:124477177-124477199 GAGAATATAAGAGCTATTGTGGG + Intronic
1015495037 6:133872480-133872502 CAGAATAGTACAGCTAGGTTTGG - Intergenic
1016753960 6:147663241-147663263 TAGAATTTTACATCAAGTATTGG - Intronic
1017581867 6:155873639-155873661 TAGAATTTTCTAGCTAGTGCAGG + Intergenic
1018775830 6:167014959-167014981 TATAATCTTACTGCTATTGTGGG + Intronic
1022864092 7:34399305-34399327 TAGTAAATTATAGATAGTGTTGG - Intergenic
1024109555 7:46131336-46131358 TAGTATATTAAAGTTAGTCTTGG + Intergenic
1031349174 7:120707545-120707567 TAAGATATTACAACTACTGTAGG - Intronic
1031387998 7:121176461-121176483 TGGAATATTACATTTAGTTTTGG + Intronic
1031701198 7:124929338-124929360 TACAATATTACAGCTCCCGTGGG - Intronic
1034027920 7:147727313-147727335 TAGAATATGAGACCTAGTTTAGG + Intronic
1034132804 7:148736205-148736227 ATGACTATTACAGCCAGTGTTGG + Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1038290316 8:26243396-26243418 TTGATTATTACATTTAGTGTGGG + Intergenic
1040536137 8:48312591-48312613 TAGAGTACTACTGCTAGTATTGG - Intergenic
1040677032 8:49762882-49762904 TAGAAGATTGCAGCAGGTGTAGG + Intergenic
1042400716 8:68343105-68343127 TAGATTATTAGAGGGAGTGTTGG - Intronic
1043646611 8:82529052-82529074 AAGTATATTACAAATAGTGTGGG - Intergenic
1044401095 8:91772949-91772971 AAGAACCTTACAGCTAGTGGTGG + Intergenic
1045042110 8:98235314-98235336 TTGAATTTTCCAGCTATTGTTGG - Intronic
1045579856 8:103466867-103466889 AAGAGTATTAAAACTAGTGTTGG - Intergenic
1046017565 8:108623580-108623602 TAATATATTAAGGCTAGTGTTGG - Intronic
1047985245 8:130226422-130226444 TAGACTAATACAGTTAGTGGTGG - Intronic
1050241348 9:3638927-3638949 TAGAATATTAAACCAAGTGCAGG - Intergenic
1053195337 9:36113465-36113487 AAGAATAATACAGGTTGTGTTGG + Intronic
1053272841 9:36762042-36762064 TAGAATCTCACAGCTGCTGTAGG - Intergenic
1188202313 X:27306482-27306504 TGGAATATTATAGCTAGAATAGG - Intergenic
1190949168 X:55125386-55125408 TAGAATATTATACATAGTTTGGG + Intronic
1196256569 X:113527209-113527231 TAAAATATTACAGCTACTTTGGG - Intergenic
1201781556 Y:17728796-17728818 TAGTATATCTCAGCTAATGTAGG + Intergenic
1201819997 Y:18177194-18177216 TAGTATATCTCAGCTAATGTAGG - Intergenic
1201854880 Y:18530314-18530336 TAGTATATCTCAGCTAATGTAGG - Intergenic
1201878441 Y:18790071-18790093 TAGTATATCTCAGCTAATGTAGG + Intronic
1202173043 Y:22071591-22071613 TAGTATATCTCAGCTAATGTAGG + Intergenic
1202218317 Y:22514780-22514802 TAGTATATCTCAGCTAATGTAGG - Intergenic
1202324868 Y:23681275-23681297 TAGTATATCTCAGCTAATGTAGG + Intergenic
1202545903 Y:25988779-25988801 TAGTATATCTCAGCTAATGTAGG - Intergenic