ID: 1152058651

View in Genome Browser
Species Human (GRCh38)
Location 17:78052066-78052088
Sequence GCCCTTGTCCTGCTGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152058651_1152058657 28 Left 1152058651 17:78052066-78052088 CCTGTGTCCAGCAGGACAAGGGC 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1152058657 17:78052117-78052139 AGGAAAGAGCGCTGCACAGGTGG 0: 1
1: 0
2: 3
3: 21
4: 185
1152058651_1152058658 29 Left 1152058651 17:78052066-78052088 CCTGTGTCCAGCAGGACAAGGGC 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1152058658 17:78052118-78052140 GGAAAGAGCGCTGCACAGGTGGG 0: 1
1: 0
2: 3
3: 10
4: 170
1152058651_1152058653 2 Left 1152058651 17:78052066-78052088 CCTGTGTCCAGCAGGACAAGGGC 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1152058653 17:78052091-78052113 TTCATCCATCTCGTGAAGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 68
1152058651_1152058655 8 Left 1152058651 17:78052066-78052088 CCTGTGTCCAGCAGGACAAGGGC 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1152058655 17:78052097-78052119 CATCTCGTGAAGCAAGGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 188
1152058651_1152058656 25 Left 1152058651 17:78052066-78052088 CCTGTGTCCAGCAGGACAAGGGC 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1152058656 17:78052114-78052136 AGCAGGAAAGAGCGCTGCACAGG 0: 1
1: 1
2: 1
3: 24
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152058651 Original CRISPR GCCCTTGTCCTGCTGGACAC AGG (reversed) Intronic
900497132 1:2980883-2980905 GCCCTGGACCTGCTAGCCACCGG - Intergenic
900647390 1:3715152-3715174 GCCCTGGTCCTGCTGGGGATGGG - Intronic
902118260 1:14139686-14139708 GCCCATGCCCTGCTGGGCACTGG - Intergenic
902733880 1:18387311-18387333 GCTCCTGGCCTGCTGGACAGTGG - Intergenic
903327996 1:22582297-22582319 GCCCTTGTCCTTCTAGTGACAGG + Intronic
904374400 1:30070958-30070980 GCCCTTGACATGGTGGACCCTGG + Intergenic
904999360 1:34656303-34656325 GGGCTTGTCATGCTGGAGACAGG + Intergenic
906102659 1:43273083-43273105 GGCCTCGTGCTGCTGGTCACCGG + Exonic
906675456 1:47690266-47690288 AGCCTTGTCCTGCAAGACACAGG - Intergenic
907962759 1:59298249-59298271 GCTCTTGACCTGATGGCCACTGG + Intronic
910263560 1:85314654-85314676 GTCCTTGTCCTGCTGGGCCTAGG + Intergenic
910561008 1:88590793-88590815 AGCCTTGTCCTCCTGGACACAGG - Intergenic
915469303 1:156116006-156116028 GCCCTTGGCCTGCTTGGCCCAGG + Intronic
915529918 1:156497543-156497565 GGCCTTGACCTCTTGGACACAGG - Intronic
916420380 1:164632469-164632491 GCCTTTCTCCTGCTGGACACAGG + Intronic
917208218 1:172600859-172600881 GCCCTAGTTCTGCTAGAAACAGG - Intronic
917579711 1:176363272-176363294 GCCCACTTCCTGCTGGACTCAGG - Intergenic
917816247 1:178713005-178713027 GGCCTTGACCTGCTGGGCTCAGG - Intergenic
918238374 1:182601038-182601060 GCTCTTGCCCTGCTCTACACAGG + Intronic
919673917 1:200362638-200362660 GCCCTTGTCCTGCCCAACACAGG + Intergenic
919760822 1:201097092-201097114 GGCCCGGACCTGCTGGACACTGG - Intronic
920388069 1:205581871-205581893 ACCCTTGCCCTGCTGCTCACTGG - Intronic
922506222 1:226127391-226127413 GCCCTAGTCCTGATGGCCCCCGG + Intergenic
923457097 1:234173968-234173990 GCCCCTTTTCTGCTGTACACAGG - Intronic
1062919268 10:1266748-1266770 GCCCCTGGCCTGGAGGACACGGG + Intronic
1065813507 10:29463924-29463946 GCCCTGGCCCTTCTGGATACTGG + Intronic
1066659951 10:37728832-37728854 CACCTTGTCATGCTGGCCACTGG - Intergenic
1067581714 10:47450561-47450583 GGCCTTTGCCAGCTGGACACTGG - Intergenic
1069522360 10:69133766-69133788 GGCCTTGTACTCCTGGACTCAGG + Intronic
1070288613 10:75100584-75100606 GCCCTGGCCCTGCTGGACGTTGG - Intronic
1075776598 10:124993121-124993143 GCTCCTGTCCTGCTGGCTACAGG - Intronic
1076573762 10:131450316-131450338 GACTGTGTCCTGCAGGACACAGG + Intergenic
1077112585 11:868530-868552 GCCCTGCTGCTGCTTGACACGGG - Exonic
1077130729 11:971180-971202 GCCCTTGTCCTGGGGGAGATGGG + Intronic
1077376694 11:2208615-2208637 CCCCCTGGCCTGCTGGGCACAGG + Intergenic
1077413744 11:2415039-2415061 GCCCTTCTCCTGGAGGACACGGG + Exonic
1078351961 11:10602169-10602191 GTCCTTGTCCTGAAGGACACAGG + Intronic
1079133330 11:17762113-17762135 GCCCTTGTCCTGCAGTAAAAGGG - Intronic
1081603512 11:44511987-44512009 GCCCTTGACCTCCTGGTCACTGG - Intergenic
1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG + Intronic
1084401010 11:68942890-68942912 ACCCTTGGCCTGCTCGGCACAGG - Intergenic
1085515756 11:77110989-77111011 CCCCTGGCCCTGCTGGGCACGGG - Intronic
1086392043 11:86375180-86375202 GCCCAGGTCCTGCAGGGCACGGG - Exonic
1089376050 11:117995621-117995643 GCCTTTGTCCTGCTGCTCTCCGG + Exonic
1090438899 11:126710152-126710174 GCCCATCTACTGATGGACACAGG - Intronic
1092757218 12:11774906-11774928 CCCCTTGTCCTGCCTGACCCCGG - Intronic
1093388101 12:18583526-18583548 GCCCTTGTCCTGCTGTCTCCAGG + Intronic
1099229618 12:80007003-80007025 GGCCTGATCCGGCTGGACACTGG - Intergenic
1099946683 12:89253118-89253140 TCCCTTGTACTGCTTGACAGAGG + Intergenic
1101210974 12:102534850-102534872 CCCCTTGCCCTGCTGGATAGAGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104381770 12:128313598-128313620 ACCCTTGTCCTGCAGGACCTTGG - Intronic
1105274453 13:18906437-18906459 CACCTTGTCATGCTGGCCACTGG - Intergenic
1118819620 14:69336488-69336510 GCTCTTCTCCTGCTAGCCACAGG + Intronic
1122027129 14:98886196-98886218 GCCCATGCACTGCAGGACACAGG + Intergenic
1202897548 14_GL000194v1_random:18979-19001 GCTGATGTCCAGCTGGACACTGG - Intergenic
1127623850 15:60761008-60761030 GCCCTTCTCCTTTTGGGCACAGG + Intronic
1128611211 15:69074903-69074925 GCCCTTGCCTTGCAGCACACTGG + Intergenic
1129030909 15:72616959-72616981 GCCCTTGTCCAGCTGTAGCCCGG + Intergenic
1129209475 15:74059267-74059289 GCCCTTGTCCAGCTGTAGCCCGG - Intergenic
1129711489 15:77822514-77822536 GCCCTTGTGCTGGTGGCCAGAGG + Intergenic
1130026864 15:80277619-80277641 GCCCTCCTTCTGCTGGACACTGG - Intergenic
1132093040 15:98960934-98960956 TCCCTGGTCCTGCTGCTCACAGG + Exonic
1132595731 16:748422-748444 GCCCGAGTCCTGCTTGACAGAGG - Intronic
1132700932 16:1221836-1221858 GCACTTGGCCAGCAGGACACAGG + Exonic
1132986391 16:2769741-2769763 GGCTTTGTCCTGCAGGCCACAGG - Intronic
1133249715 16:4473053-4473075 AGCCTTGACCTGCTGGACTCAGG + Intronic
1134486931 16:14666163-14666185 GCCTTTGTTCTGATGGACCCAGG + Intronic
1134524780 16:14935145-14935167 GCCCTTGTCCTGCAGGTGGCTGG + Intronic
1134712369 16:16333632-16333654 GCCCTTGTCCTGCAGGTGGCTGG + Intergenic
1134954458 16:18375062-18375084 GCCCTTGTCCTGCAGGTGGCTGG - Intergenic
1138869127 16:60859630-60859652 GCCCTTTTCCTGGAAGACACAGG - Intergenic
1141161770 16:81633805-81633827 GTCCTTGTACTCCTGGACAGAGG - Intronic
1141425202 16:83940371-83940393 CTCCTTGTCCTGCTGGGCTCTGG + Intronic
1143028453 17:3954234-3954256 GACCTTGTCCAGCTGGTCCCAGG - Intronic
1145868390 17:28255272-28255294 GCCCCTGTCCTGCTGCTCTCTGG - Intergenic
1145992568 17:29087910-29087932 GCCATTGGTCTGGTGGACACAGG - Intronic
1146626340 17:34438255-34438277 GCCCTCCTCCTGCTACACACAGG - Intergenic
1146640320 17:34535901-34535923 GGCCCTTTCCTGCTGGAGACAGG + Intergenic
1146675827 17:34773313-34773335 GCCCTGCTCCTGCTGAACCCAGG + Intergenic
1148071295 17:44910401-44910423 GCCCCTGTCCTGCTAGGCCCTGG - Exonic
1148638937 17:49170393-49170415 GCCTTTGTTCTGGTGGACAGTGG - Intergenic
1152058651 17:78052066-78052088 GCCCTTGTCCTGCTGGACACAGG - Intronic
1152596654 17:81241061-81241083 GCCCTAGTCCTGATGGCCCCTGG + Exonic
1152638257 17:81438984-81439006 CCCCGTGTCCTGGTGGACAGAGG + Intronic
1152747858 17:82049513-82049535 CCCCTTGGCCTGTTGGACACAGG - Intronic
1154107335 18:11534016-11534038 CACCTTGTCATGCTGGCCACTGG - Intergenic
1154466139 18:14643692-14643714 CACCTTGTCATGCTGGTCACTGG - Intergenic
1154485359 18:14867843-14867865 CACCTTGTCATGCTGGCCACTGG - Intergenic
1156788986 18:40949289-40949311 GTTTTTCTCCTGCTGGACACTGG + Intergenic
1160755581 19:755303-755325 GACCTTGTCCCGCTGGGCCCAGG - Intronic
1161459641 19:4389168-4389190 GGCCATGTTCTGCTGGGCACTGG - Intronic
1162068819 19:8141745-8141767 GCCGCTGTCCAGTTGGACACCGG - Exonic
1163194003 19:15701873-15701895 CCCTTTGTCCTGCTGGAGACTGG - Intergenic
1163645803 19:18488422-18488444 GCACATGCCCTGCTGGTCACAGG - Intronic
1165059903 19:33199999-33200021 GGCCTTGTCCTCCAGGACAGGGG + Intronic
1165191845 19:34070426-34070448 GCCCTTGTCATATTGGAAACTGG - Intergenic
1165356576 19:35308067-35308089 GCCCCTGTCTTGATGGAAACAGG + Intronic
1165445097 19:35852407-35852429 GCTCCTGGCCTGCTGGACTCTGG - Intronic
1165710853 19:38009806-38009828 GACCCTGTCCTCCTGGTCACTGG - Intronic
1166104648 19:40591237-40591259 GCCCTGGTCCTGGGGGACTCAGG + Exonic
1166546075 19:43635559-43635581 CCCCTTTTCCTTCCGGACACAGG + Intronic
1166666496 19:44683555-44683577 GGCCTTGTCCTGCTGGTCTCAGG - Exonic
926292224 2:11540190-11540212 GCCATTATTCTGCTGAACACAGG - Intronic
930523904 2:52502030-52502052 GCCCTTTTCCTGCCAGAAACAGG - Intergenic
931023284 2:58075796-58075818 TCCCTTCCCCTGCTGGAAACAGG + Intronic
931721763 2:65072072-65072094 GACCCTGTCCTGCAGGACTCCGG + Exonic
932083913 2:68740436-68740458 TCCCTTCTCCTGCTGCACACTGG + Intronic
935734405 2:106095633-106095655 GCCGGGCTCCTGCTGGACACAGG + Intronic
936092863 2:109512194-109512216 GCCCTCCTCCTGCTGGGCCCTGG + Intergenic
937035356 2:118777102-118777124 TCCTTTGTTCTGCTGGACCCTGG - Intergenic
937296380 2:120812241-120812263 GGCCCTGTCCTGCTGTACAGGGG - Intronic
937352253 2:121173486-121173508 ACCCTTCACCTCCTGGACACAGG - Intergenic
937688262 2:124722742-124722764 GCCACTGTCCTGGAGGACACAGG - Intronic
938065914 2:128281968-128281990 GCCCATGTCCACCTGGACCCAGG + Intronic
938287080 2:130127902-130127924 CACCTTGTCATGCTGGCCACTGG + Intronic
938428513 2:131210968-131210990 CACCTTGTCATGCTGGCCACTGG - Intronic
938469415 2:131544986-131545008 CACCTTGTCATGCTGGCCACTGG - Intergenic
940503681 2:154526817-154526839 GCCCTAGTGCTGGTGGCCACAGG - Intergenic
946070775 2:217032642-217032664 GTCCGTGTTCAGCTGGACACAGG - Intergenic
946870080 2:224077029-224077051 GTGCTTGTCCTGGTGGATACTGG - Intergenic
947792844 2:232877631-232877653 GACTTTCTCCTCCTGGACACTGG + Intronic
948150421 2:235740147-235740169 GCCCTGCTCCTGCTGGGCAGCGG - Intronic
948553425 2:238791374-238791396 GCCTTTGACCAGCTGGGCACGGG - Intergenic
1169427813 20:5510075-5510097 ACCCTTTTCCTGCTGGGCTCAGG + Intergenic
1170550043 20:17468719-17468741 GCCAGTGTCCTGCTGTAGACAGG + Intronic
1170984240 20:21243405-21243427 GGCCTTGTTCTTCTGGACACAGG - Intronic
1174379869 20:50149560-50149582 GCCCTGGTCCTGCAGGACCCAGG - Intronic
1175320604 20:58085061-58085083 TCCCTTGACCTCCTGGACATGGG + Intergenic
1175641409 20:60633586-60633608 GCCCATGCCCTGCTGGCCTCTGG - Intergenic
1175935462 20:62511869-62511891 GCCATTTTCCTGCTGCACCCAGG - Intergenic
1175965923 20:62660258-62660280 CCCCTGGTGCTGCTGGCCACAGG - Intronic
1176192384 20:63818165-63818187 GCCCTTGTCCAGCTCTACAAAGG - Intronic
1176617234 21:9034968-9034990 GCTGATGTCCAGCTGGACACTGG - Intergenic
1176795975 21:13371633-13371655 CACCTTGTCATGCTGGCCACTGG + Intergenic
1176808448 21:13514904-13514926 CACCTTGTCATGCTGGTCACTGG + Intergenic
1178586501 21:33875273-33875295 GGCCTGGTCCTGCAGGACCCTGG + Intronic
1180193548 21:46180877-46180899 ACCCAGGTCTTGCTGGACACGGG - Intronic
1181343913 22:22203331-22203353 GCTCTTCTCCTGGTGGACCCTGG - Intergenic
1181463532 22:23098848-23098870 GCCCTGGCCCGGCTGGAGACGGG - Intronic
1182696510 22:32202585-32202607 CACCTTGTCATGCTGGCCACTGG + Intronic
1183065427 22:35359590-35359612 GCCCTTGTCCTCCCAGCCACAGG + Intergenic
1183423114 22:37723698-37723720 GGGATCGTCCTGCTGGACACAGG - Exonic
1183470097 22:38000616-38000638 GCCCAGGGGCTGCTGGACACAGG + Intronic
1184072061 22:42152601-42152623 GGCCCTGTCCAGCTGGGCACAGG + Intergenic
1184371671 22:44086201-44086223 GCCCTTGTCATGCAGGATGCCGG - Intronic
1184396332 22:44243925-44243947 GCCCTTGTCCAGCTGGCCCTGGG + Exonic
1184524661 22:45014787-45014809 GCTGTTGTCCTGCTAGACCCTGG + Intergenic
1184538022 22:45100601-45100623 CCCCAGGTCCTGCTGAACACTGG - Intergenic
1184650336 22:45916683-45916705 GGCCTTGCCCTGCTGGCCTCAGG + Intergenic
950421434 3:12901923-12901945 GCCCTGCTCCTGCTGAAAACAGG + Intronic
952962174 3:38599104-38599126 GCTCCTGTCCTGCTGGACCTGGG + Intronic
961174347 3:124821523-124821545 GCCCTGGTCATGCAGGGCACTGG + Intronic
961220570 3:125195899-125195921 GAGCTTTTCCTGCTGGACACAGG + Intronic
966911922 3:184564609-184564631 GCCCTTATCCTGCTGGAGGGAGG + Intronic
966954494 3:184860572-184860594 GTCTATGTCCTGCTGAACACAGG + Intronic
967925214 3:194640444-194640466 GCACTTGTCCTCCTGGACAGTGG + Intergenic
967939755 3:194756770-194756792 GGCATGATCCTGCTGGACACTGG + Intergenic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
968830610 4:2931495-2931517 GCCCGTGCCCTGCAGGACTCAGG + Intronic
969212256 4:5696711-5696733 GCCCTGGCACTGCTGGACCCAGG - Intronic
969532383 4:7737055-7737077 GGCCGTTTCCTGCTGGACAGAGG - Exonic
969663532 4:8544252-8544274 GCCCCTGTCCTCCTGGAGTCTGG + Intergenic
970585855 4:17513354-17513376 GCCTTTGTCTTGCTGAACAAAGG - Intergenic
971282867 4:25255998-25256020 AGCCTTGTCCTGCTGGGCTCAGG + Intronic
982574300 4:157089315-157089337 AACCTTGTCCTCCTGGACTCAGG - Intronic
985148074 4:186915219-186915241 CCCACTGTCCTGCTGAACACTGG + Intergenic
985207833 4:187559485-187559507 CCCCGTGTCCTCCTGCACACAGG - Intergenic
987114554 5:14715605-14715627 GCCCTTGTCCTGCTTCCCACAGG + Intronic
992243012 5:74790286-74790308 GCCCCTTTCCTGAAGGACACTGG + Intronic
994473096 5:100234884-100234906 GGCATTGTCATGCTGGACATAGG - Intergenic
997879175 5:137574284-137574306 GCCCTTCTCCTGGATGACACTGG - Intronic
999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG + Intronic
1000748133 5:165061355-165061377 GCCCTTGTCCTTCTGGCCTGGGG - Intergenic
1001560361 5:172665228-172665250 GGCCTTGGCCTGCTGGGCACTGG + Intronic
1001584391 5:172823531-172823553 GCCCTGGCCTTGCTGGACACGGG + Intergenic
1001845107 5:174915497-174915519 GCCCTTGTCCAGCTGTAGCCCGG - Intergenic
1001980520 5:176034765-176034787 CGCCTTGTCATGCTGGCCACTGG + Intergenic
1002236941 5:177809300-177809322 CGCCTTGTCATGCTGGCCACTGG - Intergenic
1002724134 5:181283282-181283304 CACCTTGTCATGCTGGCCACTGG - Intergenic
1003964692 6:11241808-11241830 GCCCGGGGCCTGCTGGACATTGG - Intronic
1005098794 6:22146924-22146946 GCCCTTGCCCTGCGGAGCACGGG - Intergenic
1006638841 6:35478482-35478504 GAACTTGTTCTGCAGGACACTGG + Exonic
1007273354 6:40655524-40655546 TCCCTTTTCCCTCTGGACACAGG - Intergenic
1007380821 6:41488955-41488977 TCCCTGCTCCTGCTGGACCCGGG - Intergenic
1009942370 6:70304153-70304175 GGCCTTGTCTTGAGGGACACGGG + Intergenic
1011481538 6:87798822-87798844 GCCCATTTCCTGCTTGCCACGGG + Intergenic
1011736545 6:90316187-90316209 ACCCTTGTCCTGGTGCACTCGGG - Intergenic
1015019888 6:128460252-128460274 GCCCTTTTCCAGCTGGGCATGGG + Intronic
1017137220 6:151158707-151158729 GCCCATGTACTGCTGGCCCCCGG - Intergenic
1018360717 6:163064925-163064947 GCCCTTGTATTTCTGGAAACTGG + Intronic
1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG + Intergenic
1022737945 7:33093475-33093497 ACCCTTGTCATGCAGAACACAGG - Intergenic
1024396869 7:48879722-48879744 GCCCTTGACCTGCTGGTAACAGG - Intergenic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1027884401 7:83885057-83885079 GCCCTTTTCCTGGTAGACATGGG - Intergenic
1029765980 7:102626609-102626631 GCTCCTGTCCTGCTGGGCCCAGG + Intronic
1031523770 7:122798960-122798982 GCACTTGTCCTCCTTGTCACAGG - Intronic
1031563782 7:123269374-123269396 GACATTGTTCTGCTGAACACAGG + Intergenic
1031832048 7:126639549-126639571 GAGCTAGTCCTGCTGGAGACTGG - Intronic
1032687735 7:134252659-134252681 GCCCATGTGCTGCTGGGCATAGG - Intronic
1039202635 8:35113303-35113325 GTCCTTGTCCAGCTGGATAGTGG - Intergenic
1039970367 8:42316792-42316814 GCCCGTGTCCTGTTGGATTCTGG - Exonic
1040532621 8:48277683-48277705 GACCTGGTCTTGCTGTACACTGG - Intergenic
1042386959 8:68187872-68187894 GCCTCTGGCCTGCTGGACTCTGG + Intronic
1047495473 8:125405695-125405717 GACTTAGGCCTGCTGGACACGGG + Intergenic
1047802603 8:128325631-128325653 ACCCTTTTCCTGCAGGTCACAGG + Intergenic
1049263536 8:141652802-141652824 GCCCTTGTCCTGTTGGCCACAGG - Intergenic
1049381711 8:142319558-142319580 GACCCTGGCCTGCTGGAAACTGG + Intronic
1049636407 8:143691880-143691902 GCTCCTGCCCTGATGGACACTGG + Intronic
1053160109 9:35808240-35808262 GTCCATGTCCTGCTGCAGACAGG + Exonic
1053886275 9:42646716-42646738 CACCTTGTCATGCTGGCCACTGG - Intergenic
1054225295 9:62454165-62454187 CACCTTGTCATGCTGGCCACTGG - Intergenic
1057028908 9:91758534-91758556 GGCTTTGTCCTGCTGCACCCAGG + Intronic
1057180507 9:93027183-93027205 GCACCTGTCCTGCTTGGCACAGG - Intronic
1060028751 9:120195863-120195885 GCCCAGGACCTGCAGGACACAGG + Intergenic
1061140546 9:128763603-128763625 CCCCTTCTCCTGCAAGACACTGG - Intronic
1061805958 9:133137932-133137954 GACCAGGGCCTGCTGGACACAGG - Intronic
1061838495 9:133344333-133344355 GCCCTGGTTCTGATGGCCACAGG - Exonic
1185705814 X:2265473-2265495 TCCCTGCTTCTGCTGGACACTGG - Intronic
1192257821 X:69479880-69479902 GGCCTTGACCTCCTGGACTCAGG - Intergenic
1196774408 X:119325363-119325385 TTCCTGGTGCTGCTGGACACGGG - Intergenic
1197018270 X:121654333-121654355 AGCCTTGACCTCCTGGACACAGG + Intergenic
1199771099 X:150975876-150975898 GCCCTTGACCTTCTAGGCACCGG - Intergenic
1202082002 Y:21093105-21093127 GCTTTTGTCCTGCTGGAGCCAGG + Intergenic