ID: 1152061301

View in Genome Browser
Species Human (GRCh38)
Location 17:78077668-78077690
Sequence GTTGCCATGAGGAAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152061301 Original CRISPR GTTGCCATGAGGAAAGAGGG TGG (reversed) Intronic
900014466 1:138619-138641 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
900044331 1:493821-493843 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
900065738 1:728727-728749 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
901585923 1:10292072-10292094 GTTGCCATTCGGGAAGATGGAGG + Exonic
902501372 1:16913911-16913933 GGTGCCAGGCGGCAAGAGGGAGG + Intronic
902511797 1:16970655-16970677 GTAGCCATGAGGACACAGTGCGG + Exonic
903169309 1:21542241-21542263 GTGGGCATGAGGAATGAGGCAGG - Intronic
903647659 1:24904754-24904776 GTGGCCCTGAGGAAAGAGGCTGG - Intronic
906167363 1:43696782-43696804 GGTGCTATGAGGAAATTGGGGGG + Intronic
906264865 1:44420995-44421017 ATGGCAATGTGGAAAGAGGGAGG + Intronic
906414393 1:45608956-45608978 GTTGCCTTGGGGAAGGTGGGGGG - Intronic
907617278 1:55938037-55938059 GTTCCCACAAGGACAGAGGGTGG + Intergenic
907953092 1:59202855-59202877 TTTGCTTTGAGGAAAAAGGGTGG - Intergenic
910081297 1:83345168-83345190 GTTACCATGATGATAGAGGATGG + Intergenic
911939219 1:104020198-104020220 GCTGCCAGGGGGGAAGAGGGAGG + Intergenic
912201506 1:107463074-107463096 GCTGACATGAGGAAAGGGAGGGG - Intronic
912593999 1:110855858-110855880 GTTGCCAAGAGGTAGGAGGGAGG + Intergenic
913244053 1:116856037-116856059 GCTGGCAGGAGGAGAGAGGGAGG - Intergenic
913416448 1:118614300-118614322 GCTGCCATTAGGAAAGTGGTTGG - Intergenic
914752425 1:150544398-150544420 GTTACAATGAGGACAGAGTGAGG + Intergenic
915793524 1:158701940-158701962 GTGGCAATGAAGACAGAGGGAGG - Intergenic
915938587 1:160103844-160103866 GGTGGTATGGGGAAAGAGGGAGG + Intergenic
918197991 1:182240629-182240651 GTTTCCATGAGGAAAGCTGAAGG - Intergenic
918579129 1:186104578-186104600 GTTGCCATGAGGGGAATGGGTGG - Intronic
919205511 1:194417311-194417333 GATGCCATGAAGAAAGTGGAGGG + Intergenic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
920847324 1:209605169-209605191 GAAGCCATGATGAAAGAGAGAGG - Intronic
921511749 1:216039984-216040006 GTGGGCAGGGGGAAAGAGGGAGG - Intronic
922100863 1:222476076-222476098 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
924343785 1:243056193-243056215 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
924949647 1:248870748-248870770 GGTGGAATGAGGAAAGAGGGTGG + Intergenic
1063889903 10:10618538-10618560 GTTGCCATGAGGAATGGTCGGGG - Intergenic
1065241522 10:23709583-23709605 TTTTCCATTAGGAAAGAAGGAGG - Intronic
1065689165 10:28315509-28315531 GTGGCCAGGAGGGAAGTGGGAGG - Intronic
1065918101 10:30368860-30368882 GTCGCCATCAACAAAGAGGGAGG - Intronic
1066342739 10:34551743-34551765 GTGGCCATGGGGAAGGAGAGAGG + Intronic
1068897564 10:62224178-62224200 GCTGCCAGGAGGATAGAAGGAGG + Intronic
1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG + Intronic
1070849600 10:79552739-79552761 GTTTCCATGAATAAATAGGGAGG - Intergenic
1071766420 10:88670834-88670856 GTTGCCAGGGGCAAAGAGGCAGG + Intronic
1073108480 10:101047071-101047093 GATGCCGGCAGGAAAGAGGGAGG - Intergenic
1073378079 10:103054175-103054197 GATGCCACGGGGAAGGAGGGAGG - Intronic
1073475101 10:103747443-103747465 GCTGCCCTCAGGAAAGACGGTGG + Intronic
1073597590 10:104816683-104816705 TTTGTGGTGAGGAAAGAGGGAGG + Intronic
1073881075 10:107980687-107980709 GTTGCCAGGAAGAAGGAGGTAGG - Intergenic
1074158175 10:110816186-110816208 GTGGCCATGAGTAAAGACGAAGG - Intronic
1074912207 10:117921623-117921645 GATACCATGAGGAGAGAAGGGGG - Intergenic
1075213891 10:120515276-120515298 GTGGTCATGAGCCAAGAGGGAGG - Intronic
1075718375 10:124570187-124570209 GGTGCCATGGGGACAGAGAGGGG - Intronic
1076642699 10:131929598-131929620 GTTTCCACGAGGCATGAGGGAGG - Intronic
1076826698 10:132973091-132973113 CCTGACATGAGGAAAGAGGCAGG - Intergenic
1076970663 11:130296-130318 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
1080344655 11:31311046-31311068 GAAGCCATGAGGAAAGGGGGAGG - Intronic
1080794061 11:35547222-35547244 GTAGACATGAGGAAAGAAAGAGG - Intergenic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1081848715 11:46260103-46260125 GCTGCTGTGAGGCAAGAGGGAGG + Intergenic
1082260378 11:50073148-50073170 GCTGCCATGAGGAAAGAGCTGGG + Intergenic
1084174214 11:67415346-67415368 GCTGCCATGAAGAAAGAGGGAGG - Intronic
1084565984 11:69929350-69929372 GTGCCCAAGAGGAAAGAGGCCGG - Intergenic
1084704094 11:70805966-70805988 CTGGCCATCAGGCAAGAGGGCGG + Intronic
1085791985 11:79504291-79504313 GAAGCCATGAGGAAGGAGAGAGG - Intergenic
1086581068 11:88399320-88399342 GTTCTCATCAGAAAAGAGGGTGG - Intergenic
1087052033 11:93896093-93896115 GGTGGGATGAGCAAAGAGGGAGG - Intergenic
1087303493 11:96462122-96462144 GTTGCCATGAGGAAAAAGCCTGG + Intronic
1089932623 11:122329314-122329336 TTTGCAAAGAGGGAAGAGGGTGG + Intergenic
1090401262 11:126449762-126449784 CTTGTCAAGAGGAAAGAGAGGGG - Intronic
1091583511 12:1802746-1802768 CTTGGCATGAGGACAGAGGAAGG - Intronic
1092668885 12:10839840-10839862 GTTGCCATAAAGAAATAGAGGGG + Intronic
1092785356 12:12021614-12021636 GTTGCCAGGGGGTAATAGGGAGG + Intergenic
1092895071 12:13002515-13002537 GCTGTCAGGAGGAAAAAGGGCGG - Intergenic
1094483848 12:30908252-30908274 GTTGCCAAGGGTAAAGAAGGGGG + Intergenic
1095304920 12:40627584-40627606 GTTCCCATGTGGACAGAGAGTGG + Intergenic
1096861411 12:54531390-54531412 CCTACCTTGAGGAAAGAGGGTGG + Intronic
1098403464 12:70098503-70098525 CTTTGCATGAGGTAAGAGGGAGG + Intergenic
1099250083 12:80243993-80244015 GGTGCCATGATGAAGAAGGGAGG - Intronic
1102495401 12:113315862-113315884 GTTGGCACAAGGAAAGAGGGAGG - Intronic
1102790253 12:115638814-115638836 GTTGCCAAGAGGAGGCAGGGAGG - Intergenic
1104689657 12:130815995-130816017 CTTGCTATGAATAAAGAGGGTGG + Intronic
1106396890 13:29389011-29389033 ACTGCTATGAGGAAAGAAGGGGG - Intronic
1108452560 13:50581957-50581979 TTTGCCATGAGGGCAGAGAGAGG + Intronic
1109979885 13:69894043-69894065 GTTGCCATCAGGAAAACGGTTGG - Intronic
1110289336 13:73786060-73786082 GTTGCCCTGTGCAAAGAGGCTGG + Intronic
1110475123 13:75904884-75904906 GTTCCCATGTCGAGAGAGGGAGG - Intergenic
1110863747 13:80372110-80372132 GTTGCTATGTGGGATGAGGGTGG + Intergenic
1111991347 13:95120502-95120524 GTTGCCATGAGCCAAGATGATGG + Intronic
1112241013 13:97680948-97680970 GTTGCCATGGGGTTAGCGGGAGG - Intergenic
1112303488 13:98251706-98251728 GTCCCCATTAGGGAAGAGGGAGG + Intronic
1114618973 14:24083521-24083543 CTGGCCTTGAGGAAAGATGGTGG - Intronic
1116754858 14:48935082-48935104 GTTGCCATAAGCAAAAAGTGGGG + Intergenic
1117008375 14:51445323-51445345 GATGACATCAGGAAAGAGGGAGG - Intergenic
1117059860 14:51951069-51951091 GTTTCCATGAGGACAGGGAGGGG - Intronic
1117659500 14:57988680-57988702 CTTTCCATCAGGAAAGGGGGTGG + Intergenic
1117799281 14:59426877-59426899 ATTGAAATGAGGAAAGAGGGTGG - Intergenic
1118030816 14:61816202-61816224 GTTGCCAACAAGAAAGAAGGAGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118750865 14:68807186-68807208 GTTGCCATGTGGACAGCCGGCGG + Intergenic
1118789469 14:69076608-69076630 GTTGCCAGGAGCTAAGAGGAGGG + Intronic
1119081341 14:71697131-71697153 GTTGACTTGATGGAAGAGGGTGG + Intronic
1120088372 14:80302012-80302034 GCTGCCATGTTGAAAGAGAGGGG + Intronic
1120944647 14:89982604-89982626 GTTGCCAGGAGGGAAGAGGCAGG + Intronic
1122267944 14:100555350-100555372 TGAGCCATGAGGAACGAGGGTGG - Intronic
1125380526 15:39081913-39081935 GTGGCCATGATTTAAGAGGGTGG - Intergenic
1128091016 15:64918890-64918912 GTTGCCATGAGCCAAGATTGTGG + Intronic
1129037895 15:72662010-72662032 GTCCCCATCAGCAAAGAGGGAGG + Intronic
1129211994 15:74075217-74075239 GTCCCCATCAGCAAAGAGGGAGG - Intronic
1129398409 15:75265868-75265890 GTCCCCATCAGCAAAGAGGGAGG + Intronic
1129402017 15:75290143-75290165 GTCCCCATCAGCAAAGAGGGAGG + Intronic
1129729120 15:77919538-77919560 GTCCCCATCAGCAAAGAGGGAGG - Intergenic
1129839384 15:78734410-78734432 GTCCCCATAAGCAAAGAGGGAGG + Intergenic
1130259714 15:82345623-82345645 GTCCCCATCAGTAAAGAGGGAGG - Intronic
1130269005 15:82433813-82433835 GTCCCCATCAGTAAAGAGGGAGG + Intronic
1130281519 15:82523386-82523408 GTCCCCATCAGTAAAGAGGGAGG + Intergenic
1130472892 15:84239569-84239591 GTCCCCATCAGTAAAGAGGGAGG + Intronic
1130480383 15:84354140-84354162 GTCCCCATCAGTAAAGAGGGAGG + Intergenic
1130491386 15:84433989-84434011 GTCCCCATCAGTAAAGAGGGAGG - Intergenic
1130503002 15:84513029-84513051 GTCCCCATCAGTAAAGAGGGAGG - Intergenic
1130595185 15:85244203-85244225 GTCCCCATCAGTAAAGAGGGAGG + Intergenic
1131282805 15:91034500-91034522 GTCCCCATCAGCAAAGAGGGAGG - Intergenic
1131380237 15:91957464-91957486 GATGCCACCAGGAAAGAAGGTGG - Intronic
1132689087 16:1174505-1174527 GTGGCCATGGGGAGGGAGGGAGG + Intronic
1134267105 16:12701927-12701949 GTAGGCATGAGAAAACAGGGGGG - Intronic
1134842032 16:17409458-17409480 TTTGCCAGGAGAAAAGATGGGGG + Intronic
1139661731 16:68425520-68425542 GATGCCATGAGGACAATGGGTGG + Intronic
1140432760 16:74918974-74918996 GTGGACATGAGGCAAGATGGTGG - Intronic
1142294515 16:89211604-89211626 GGTCCCATGAGGGAAGAGTGGGG + Intergenic
1142890642 17:2940455-2940477 GTTGCCATGGCGAGAGGGGGAGG + Intronic
1142900210 17:3007031-3007053 TCTGCCAGGAGGAAAGAGTGGGG + Intronic
1142903378 17:3026927-3026949 GCTGCCCTGAGGAGAGAGGCAGG - Exonic
1143408878 17:6696599-6696621 GTTGGCATGAGGAGGCAGGGAGG + Intronic
1143702891 17:8674722-8674744 ATTTCCTTGAGGAAAGAGGCAGG + Intergenic
1144726477 17:17504970-17504992 GATGCCAGGAGGAGAGGGGGAGG + Intergenic
1144944146 17:18961251-18961273 GTTGCCATGAGGTCACCGGGAGG - Intronic
1145097375 17:20042347-20042369 GTCACCATGGGGGAAGAGGGAGG + Intronic
1145998177 17:29116265-29116287 GATGCCAGGGGGCAAGAGGGAGG - Intronic
1146954817 17:36931377-36931399 GTTGCCACCAGGCAAGAGAGAGG - Intergenic
1147119164 17:38325520-38325542 GTTGCCTTGACAAAAGAGAGAGG + Intronic
1149004855 17:51794997-51795019 GATGGCATCAGGAAAGAGGCTGG + Intronic
1151296808 17:73192336-73192358 GTGGCCATGGGGGAGGAGGGCGG - Intergenic
1152061301 17:78077668-78077690 GTTGCCATGAGGAAAGAGGGTGG - Intronic
1152322270 17:79614300-79614322 GGTGCCGTGAGGGAAAAGGGGGG - Intergenic
1152736460 17:81999794-81999816 GTGGCCGGGAGGCAAGAGGGAGG - Intronic
1152983501 18:301293-301315 GTTGCCAGGAAGGAAAAGGGAGG - Intergenic
1153502930 18:5767440-5767462 ATTGGCATGAGGAAAGCTGGTGG + Intergenic
1156427973 18:37036689-37036711 GTTTTCATGTGGAAAGAGGGTGG - Intronic
1156661557 18:39351874-39351896 GTTGACATGTGGAAAGAGAGAGG + Intergenic
1157073978 18:44444512-44444534 CTTTCCTAGAGGAAAGAGGGAGG - Intergenic
1157146585 18:45169442-45169464 GTTGGCAGGAGGCAAGAGGCAGG - Intergenic
1157149746 18:45204918-45204940 GTTTGTATGAAGAAAGAGGGAGG + Intergenic
1157578791 18:48761309-48761331 GTGGCCTGGTGGAAAGAGGGTGG - Intronic
1157826840 18:50819952-50819974 GCTGGCATGAGGGAAGAAGGAGG - Exonic
1158827478 18:61239694-61239716 GATGCCATTAGCAAAGATGGTGG - Intergenic
1158839836 18:61373477-61373499 AGTGCCATGAGGGAAGATGGAGG - Intronic
1158887527 18:61842536-61842558 TTTGCCATGAAGGAAGAGAGAGG - Intronic
1160725143 19:614522-614544 GATGCCATGTGGAAACGGGGAGG + Intronic
1161306593 19:3572540-3572562 GTTGCCATGGGGACGGAGGTGGG - Intronic
1161635008 19:5382710-5382732 GTAGCAGTGAGGAAAGAGAGAGG - Intergenic
1162234871 19:9300768-9300790 GTTGCCAAGATTTAAGAGGGAGG + Intronic
1163019674 19:14475457-14475479 ATTGCCAGGAGCAGAGAGGGGGG - Intergenic
1167877296 19:52424915-52424937 GTAGCAATGAGGAAGGAGAGTGG - Intergenic
925362336 2:3288274-3288296 GTTTCAATGAGGTATGAGGGTGG - Intronic
925619826 2:5781522-5781544 GTAGCAGTGAGGAAAGGGGGCGG - Intergenic
926347589 2:11962581-11962603 GTTGGCAGGAGGAAAAAGGGAGG - Intergenic
926710552 2:15876063-15876085 GTTGCCATGAGTCAAGATGATGG + Intergenic
927749700 2:25656593-25656615 GTTGAAATGGGAAAAGAGGGTGG - Intronic
927967198 2:27278105-27278127 GGTGCCAGGAGGATTGAGGGAGG + Intronic
928593074 2:32836980-32837002 GTTGCCAGGAGCACAGAGGGAGG - Intergenic
930158720 2:48131294-48131316 GTTGGAATGAGGAAAGAGAGCGG + Intergenic
931225005 2:60321988-60322010 GTCGCCGTGAGGACAGAGGTGGG + Intergenic
931606100 2:64053618-64053640 CTTGGCATGGGGAAAGAGAGAGG + Intergenic
933136462 2:78741948-78741970 CCAGCCATGAGGAAAGAGGTTGG - Intergenic
933182228 2:79240370-79240392 CTTACCTTGAGGATAGAGGGTGG - Intronic
935870331 2:107441195-107441217 GGTGGGATGAGGAAAGTGGGAGG + Intergenic
936751715 2:115650396-115650418 GCTGGCATGGGGAAAGGGGGGGG + Intronic
936999293 2:118450105-118450127 GTTGCCAAGGGGAGAGAGGGAGG - Intergenic
938593105 2:132758663-132758685 GATGCCAAGAGGAGAGAGAGAGG - Intronic
938803236 2:134782642-134782664 GGTGCCATCAAGAAAGAGGCAGG - Intergenic
939120579 2:138111294-138111316 GATGCCATGAGGAGATAGGAAGG - Intergenic
941822512 2:169856757-169856779 GTTGCAATGAGCCAAGATGGCGG + Intronic
942088590 2:172465714-172465736 GTTTCCATGAGGGAGGAGAGTGG + Intronic
942256728 2:174109955-174109977 GTCTACTTGAGGAAAGAGGGTGG - Intronic
943343139 2:186705408-186705430 GTTGCCATGAGGTAGGAGGCAGG - Intronic
945170494 2:206989915-206989937 GCTGTCATCATGAAAGAGGGGGG - Intergenic
945266364 2:207895191-207895213 TTAGCCAAGAGGAGAGAGGGAGG - Intronic
945973401 2:216252163-216252185 GTTTCCCATAGGAAAGAGGGTGG + Intergenic
946479408 2:220039839-220039861 GATGCCATTATGAGAGAGGGTGG + Intergenic
946894547 2:224310022-224310044 CATGCCGTGAGGAAGGAGGGAGG - Intergenic
948204516 2:236156200-236156222 GGAGCCTTGAGAAAAGAGGGAGG + Intergenic
948864651 2:240769161-240769183 GTGGCCATGAGGGAGGATGGCGG - Exonic
1169628196 20:7596724-7596746 GTTGCCATGGGGATAGGGGAGGG - Intergenic
1169931712 20:10839985-10840007 GGTGCAAAGAGGAAAGAGTGTGG + Intergenic
1170083348 20:12501308-12501330 GTTGAACTGAGGAAAGAGGATGG - Intergenic
1170136088 20:13075094-13075116 CTTGGCATGAGGATAGAGAGAGG + Intronic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1171750334 20:29043135-29043157 GATGCCAGGAGAAAGGAGGGTGG - Intergenic
1173278103 20:41602291-41602313 TTTGCCAGGAAGAAAGAGAGAGG - Intronic
1174856131 20:54047123-54047145 GAAGCCATGAGGCAAGAGAGAGG - Intronic
1175176767 20:57117289-57117311 GTTCCCATGAGGGAAGAGTCTGG - Intergenic
1175337308 20:58205035-58205057 GTTGGCAGGAGGCAAGAGTGGGG - Intergenic
1175577021 20:60067785-60067807 GTTGGCATGGGGAACAAGGGTGG - Intronic
1175605249 20:60307491-60307513 GTTTCCATAAAGAAAGAGTGAGG - Intergenic
1175799305 20:61792094-61792116 GTTGCCCTGAGGAGAGATGTGGG + Intronic
1178376786 21:32073924-32073946 ATTGCCATGTGGGAGGAGGGCGG - Intergenic
1178572394 21:33751278-33751300 TTTGCCATCAGGCAAGAGTGAGG + Intronic
1180201458 21:46227286-46227308 GTTGCCTTGAGGGAGGAGGAAGG - Intronic
1181015428 22:20066015-20066037 GAAGCCGTGAGGAAAGGGGGAGG - Intergenic
1182052128 22:27321415-27321437 GCTGCCATGAGGACTGATGGAGG + Intergenic
1182578794 22:31291429-31291451 GTTGCCACGAGAGGAGAGGGAGG - Intronic
1183663702 22:39235512-39235534 GGTGCCAGGAGGAGGGAGGGCGG - Intronic
1184281687 22:43440995-43441017 GTTGTCATTTGGAAAGAAGGTGG - Intronic
1184344918 22:43907393-43907415 GATGCCATTTGGGAAGAGGGGGG - Intergenic
1184465438 22:44666724-44666746 CTTGCCAGGAGGGAGGAGGGAGG + Intergenic
950428895 3:12939639-12939661 GTTCCAAAGAGGTAAGAGGGAGG - Intronic
950483146 3:13257060-13257082 GCTGCCATGAGGATTAAGGGAGG + Intergenic
950560165 3:13716682-13716704 TCTGCCAGGAGGAAAGAGGAAGG + Intergenic
950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG + Intergenic
953389510 3:42526250-42526272 GTTCCCATGAGGCAGTAGGGTGG - Intronic
953469776 3:43156788-43156810 GTTGACAGGAGTAAAAAGGGAGG + Intergenic
953593345 3:44282501-44282523 TTTGCCATGAGGAAATGGGATGG - Intronic
954757906 3:52851984-52852006 GCTGCTATGAGGACAAAGGGAGG + Intronic
956517861 3:70069675-70069697 GTTGTCATGAGGACCGAGTGAGG - Intergenic
956551653 3:70467550-70467572 GTAGGGATGGGGAAAGAGGGTGG - Intergenic
958015385 3:87934347-87934369 GTTGGAATGGGGACAGAGGGTGG - Intergenic
958164030 3:89855874-89855896 GTTTCCATATGGAAAGAGTGAGG - Intergenic
958414875 3:93861879-93861901 GTTGGCATGAGGGAAAATGGAGG + Intergenic
959821204 3:110737434-110737456 GTTGCCTTTAGGGAATAGGGAGG + Intergenic
963364325 3:144315723-144315745 CTTTCCATGAGGCTAGAGGGTGG + Intergenic
963633787 3:147767883-147767905 CTTGCCATGGGGAAAGAGTGGGG - Intergenic
967725675 3:192860189-192860211 GTAGCCAAGAGTGAAGAGGGAGG - Intronic
968509506 4:989209-989231 GCTGCCAGGAGGAAGGAGGGGGG - Exonic
969683879 4:8658171-8658193 GTTGCCAGGAGGCTTGAGGGAGG - Intergenic
969959442 4:10929015-10929037 GCTCCCAAGAGGAAAGTGGGAGG + Intergenic
969967760 4:11014502-11014524 GTTGACAGGAGGCATGAGGGTGG + Intergenic
970481665 4:16482223-16482245 TTTACCATGAGGAAAGATGATGG + Intergenic
971150629 4:24027847-24027869 GTTGCAAGGTGGAAAAAGGGTGG - Intergenic
972568581 4:40290458-40290480 CTTGACCTGAGGAAGGAGGGTGG - Intergenic
975411491 4:74056644-74056666 GTTGACAGTAGGAAAGAGGTAGG + Intergenic
979258927 4:118631494-118631516 GCTGCCATGAGGCAAGAGCTGGG - Intergenic
979329425 4:119409063-119409085 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
981216461 4:142175055-142175077 GTTGCCAGAAGGAAAGAAGAGGG + Intronic
981800876 4:148654225-148654247 TTTCCCATGAGGAAAGAAGTGGG + Intergenic
982216896 4:153090495-153090517 TTAGCCAGCAGGAAAGAGGGTGG + Intergenic
983894504 4:173067956-173067978 GTTGCCACGTGGAAAGATGCAGG + Intergenic
983951110 4:173642634-173642656 GAAGCCCTTAGGAAAGAGGGAGG + Intergenic
984543677 4:181073110-181073132 TTTGACATGAGGAAAGAAGTTGG - Intergenic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
985954713 5:3255315-3255337 GTTGCTATGAGGATAGAAGAGGG - Intergenic
986889380 5:12282934-12282956 GTTGCCAGGAGTAGAGAGGAGGG - Intergenic
987651992 5:20753400-20753422 GTTGCCATGGGGCAGGAGAGGGG + Intergenic
988209852 5:28189337-28189359 GTTGCCAATAGAAAAGAGGATGG - Intergenic
988743570 5:34108076-34108098 GTTGCCATGGGGCAGGAGAGGGG - Intronic
988969876 5:36456682-36456704 GTTGCCAAAAGGAAGGAAGGTGG + Intergenic
988974646 5:36502862-36502884 GCTGCCATGGGGATAGAGAGAGG + Intergenic
990365796 5:55069150-55069172 GTGGCCATGAGGAAAAGAGGTGG + Intergenic
992495514 5:77289511-77289533 GTTACCAGGAGGAAAGAATGGGG + Intronic
993639338 5:90382961-90382983 ATTGCAATGAGTACAGAGGGAGG - Intergenic
993956122 5:94235008-94235030 TTTTGCCTGAGGAAAGAGGGAGG - Intronic
994044271 5:95290633-95290655 GTGGCCAGAAGGAGAGAGGGAGG + Intergenic
994239741 5:97406825-97406847 GTTCCCATGTGGAAAGGGGAGGG - Intergenic
995073132 5:107948033-107948055 TTTCCCATGAGGAAAGTTGGCGG - Intronic
995752946 5:115472722-115472744 GAGGCCAAGAGGAGAGAGGGAGG + Intergenic
996584630 5:125071571-125071593 GTTGTCATGAGGTAAGAATGTGG + Intergenic
996633000 5:125659870-125659892 GAAGTCATGAAGAAAGAGGGGGG + Intergenic
997813334 5:136993408-136993430 TATGCCCTGAGGGAAGAGGGAGG - Intronic
999532806 5:152480735-152480757 GTTGCAGTGAGCAAAGATGGCGG + Intergenic
1000167290 5:158664633-158664655 GTTGCCAGGGGTAAAGAGAGAGG + Intergenic
1000339405 5:160265789-160265811 GTTGCCATGAGCCAAGATCGGGG + Intronic
1000420881 5:161036640-161036662 CTAGATATGAGGAAAGAGGGCGG - Intergenic
1001224539 5:169932434-169932456 GCTGCCATGTGGCAAGAGAGAGG + Intronic
1002729512 5:181325108-181325130 GCTGCCATGAGGCAAGAGCTGGG - Intergenic
1004320545 6:14628341-14628363 GGTGCCAGGAGCAAAGATGGAGG - Intergenic
1006966454 6:37990837-37990859 GTGGCCAAGAGGAAAGGGTGAGG - Intronic
1007311907 6:40953396-40953418 GGTTACATGAGGAAAGAAGGGGG + Intergenic
1007459863 6:42010206-42010228 GTTGTCATGAGAAGAGAGGGAGG - Intronic
1007716224 6:43857711-43857733 CTGGCCATGAGCATAGAGGGAGG - Intergenic
1010509222 6:76697302-76697324 GTTGGCAGGAGGCAAGAGGTAGG + Intergenic
1011650507 6:89502136-89502158 GTTGCTATGAAGAAACATGGTGG - Intronic
1011937541 6:92799731-92799753 GTTGGCATGAAGAAGGAGGTTGG - Intergenic
1012019260 6:93895660-93895682 GTTGAGTTGAGGAAAGAAGGGGG + Intergenic
1012188850 6:96256028-96256050 AATGCCATGAAGAATGAGGGTGG - Intergenic
1012499711 6:99875134-99875156 GCTGCAATGAGGGAAGTGGGAGG + Intergenic
1014879389 6:126704072-126704094 GTAGCCATGGAGAAAGAGGTGGG - Intergenic
1018862402 6:167720594-167720616 GGTCCCAGGAGGAAAGAGAGTGG - Intergenic
1018873393 6:167799846-167799868 GGGGCCACGAGGAAGGAGGGAGG + Intergenic
1019843660 7:3475043-3475065 GTTGCCATGTGGAAAATGGACGG - Intronic
1020107925 7:5430768-5430790 CCTGGCATGAGGAAGGAGGGGGG + Intergenic
1020111600 7:5451010-5451032 TTTCCCATGAGGAAAGAAGATGG - Intronic
1021233235 7:18110733-18110755 GTTGGAGTGAGGAAAGACGGGGG + Intronic
1021239113 7:18178546-18178568 GTTACTAAAAGGAAAGAGGGTGG - Intronic
1021622897 7:22565502-22565524 CCTGCCATGAGGAGAGGGGGGGG - Intronic
1022137507 7:27462979-27463001 GTTGCCATCAGGAAAATGGCTGG + Intergenic
1022955501 7:35376643-35376665 GTGGCCATGAGGGAAGACGGAGG + Intergenic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023612197 7:41982260-41982282 ATTGCTATAAGGAAAAAGGGAGG + Intronic
1023895524 7:44429797-44429819 AATGACATGAGAAAAGAGGGTGG + Intronic
1024592013 7:50895260-50895282 GTTACCATAAGAAATGAGGGTGG - Intergenic
1024649501 7:51391656-51391678 GCTGCCATGAGGCAAGAGCTGGG + Intergenic
1027876599 7:83778156-83778178 TATGCCATGAGGAAAGATGCAGG + Intergenic
1028162050 7:87497080-87497102 GATGCCATGATGCAAGATGGTGG - Intergenic
1029306748 7:99625208-99625230 GGTGCCATGAGGATGAAGGGAGG + Intronic
1030046688 7:105503507-105503529 GTTGTATTGAGTAAAGAGGGAGG - Intronic
1032051232 7:128652229-128652251 GCTGCCATGAGGCAAGAGCTGGG - Intergenic
1033425985 7:141244763-141244785 GTTTCCAGGATGAAAGAGGAAGG + Intronic
1034287536 7:149897988-149898010 GTTGCAATGAGAAAAGGAGGTGG - Intergenic
1034658112 7:152745374-152745396 GCTGCCAGGAGGAAGGAGGCTGG + Intergenic
1034663591 7:152794919-152794941 GTTGCAATGAGAAAAGGAGGTGG + Intronic
1035786944 8:2269169-2269191 TTTGCCAAGAGGAGAAAGGGGGG - Intergenic
1035805863 8:2452547-2452569 TTTGCCAAGAGGAGAAAGGGGGG + Intergenic
1036207249 8:6814455-6814477 GTTGCCAGGAGGGAAGGAGGTGG + Intronic
1037003752 8:13751345-13751367 GTGGCCAGGAGGAAAGATAGGGG - Intergenic
1045348792 8:101318733-101318755 GTTGCCAGGAGTAGAGAGGAAGG + Intergenic
1045546721 8:103135966-103135988 GTTCTCATGAGAAAAGAGGCTGG - Intronic
1046110791 8:109721585-109721607 GTTACCATGATAAAAGAGGCTGG - Intergenic
1047306700 8:123658542-123658564 GTTTGCAGGAAGAAAGAGGGGGG - Intergenic
1048228451 8:132613510-132613532 GTTGCCATGAAGACAGAGAATGG + Intronic
1048274653 8:133057092-133057114 GTTGCCCAGTGGAAAGAAGGGGG - Intronic
1048357451 8:133665135-133665157 GTTTGCATGAGGAAGGAGGCAGG + Intergenic
1048935932 8:139357070-139357092 GTTGAAAGGAGGTAAGAGGGTGG + Intergenic
1048990858 8:139759392-139759414 ATTGCCATGAGGAAGGTGAGAGG + Intronic
1050797668 9:9564404-9564426 GTTGGCATGAGGAATGCAGGGGG + Intronic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1055331027 9:75183948-75183970 CTTGGCATGAGTAAAGAGGAGGG - Intergenic
1055515013 9:77024740-77024762 GAAGCAATGAGGAAGGAGGGTGG + Intergenic
1056103999 9:83328986-83329008 GTGGCCATGAAGAAGGAGAGAGG - Intronic
1056113549 9:83420479-83420501 GTTGCCATTAGGAGAGGGGTGGG - Intronic
1057636533 9:96774630-96774652 ATTGGCATGTGGAAAGATGGAGG - Intronic
1057905368 9:98978455-98978477 GTTCCCAGCAGGAAAGAGAGAGG + Intronic
1059165744 9:112074937-112074959 GTGGCCATGAGCACAGAGAGAGG + Intronic
1061210099 9:129186512-129186534 GCTGCCATGAGGAAGGATGAAGG - Intergenic
1061907069 9:133704237-133704259 GTTGCCATGGGGATGGAAGGTGG + Intronic
1203435761 Un_GL000195v1:135598-135620 GTGGCCATTAGGAATCAGGGGGG - Intergenic
1203577483 Un_KI270745v1:20377-20399 GCTGCCATGAGGCAAGAGCTGGG - Intergenic
1188154893 X:26729529-26729551 GTTGCCAGGAGTTAACAGGGAGG - Intergenic
1188951012 X:36375185-36375207 GTGGCAATGCGGAAAGATGGCGG + Intronic
1189280634 X:39818268-39818290 GTGGCCGTGTGAAAAGAGGGCGG + Intergenic
1189872539 X:45399077-45399099 GTAGCCATAAGGAAAGGGAGAGG + Intergenic
1190023780 X:46903740-46903762 GTTCCCATGGGGGAAGAAGGCGG - Intergenic
1190065826 X:47241183-47241205 GAAGCCAGGAGGAAAGAGAGAGG - Intronic
1190292104 X:48999954-48999976 TTTTCCCTTAGGAAAGAGGGAGG - Intronic
1190848390 X:54215261-54215283 GTTGCCGTGAGCCAAGATGGCGG - Intronic
1192262063 X:69511400-69511422 GGAGGCAGGAGGAAAGAGGGTGG - Intronic
1192313295 X:70033677-70033699 GTTGAAAGGAGGAAAGAGAGAGG + Intronic
1193516254 X:82468463-82468485 GTAACAATGAGGACAGAGGGAGG - Intergenic
1194341365 X:92710255-92710277 GTCGCCATGAGGAACCAGAGAGG - Intergenic
1194910505 X:99637075-99637097 GTTGCCAAGAGCCAAGAAGGGGG + Intergenic
1197727170 X:129784093-129784115 GTTGCCCTGGGGGAAGGGGGGGG - Intronic
1200649716 Y:5826967-5826989 GTCGCCATGAGGAACCAGAGAGG - Intergenic
1202133766 Y:21639034-21639056 GTAGCCATGAAGAAAGAGACAGG + Intergenic