ID: 1152061571

View in Genome Browser
Species Human (GRCh38)
Location 17:78079798-78079820
Sequence CTGGTCAGAAGCAATATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152061564_1152061571 10 Left 1152061564 17:78079765-78079787 CCTCAGCCACCGAAACTAGCATT 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152061567_1152061571 1 Left 1152061567 17:78079774-78079796 CCGAAACTAGCATTTGGCATCTT 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152061566_1152061571 4 Left 1152061566 17:78079771-78079793 CCACCGAAACTAGCATTTGGCAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152061563_1152061571 20 Left 1152061563 17:78079755-78079777 CCTTGGAATGCCTCAGCCACCGA 0: 1
1: 0
2: 2
3: 10
4: 120
Right 1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152061571 Original CRISPR CTGGTCAGAAGCAATATTGA GGG Intronic
900374131 1:2345581-2345603 CTGGTCAGTAGCAATGCTGCCGG - Intronic
901655999 1:10769811-10769833 CTGGCCAGAAGTAATATTTAAGG + Intronic
909494072 1:76258540-76258562 CTGGGATGAAGCAATATTGGAGG + Intronic
912655025 1:111478303-111478325 CTGGCCAGAGGAAAGATTGATGG + Exonic
915262701 1:154689561-154689583 CTGGCCAGAAGCAATGCTCAGGG + Intergenic
916293639 1:163192626-163192648 CAAGTCATAAACAATATTGAGGG + Intronic
919847998 1:201653757-201653779 CTGGGCAGCAGCAGTAGTGATGG + Intronic
920928677 1:210366717-210366739 CTGGTCTATAGCAATATTTAAGG + Intronic
923586884 1:235281080-235281102 CTGGTGAGAAGCCACCTTGATGG - Intronic
923759942 1:236832948-236832970 CTGGACAGCAGCAAGAATGAGGG - Intronic
1065684614 10:28271523-28271545 CTTGAAAGAAGCAATATTTAGGG - Intronic
1067147675 10:43705071-43705093 CTGCAAAGAAGCAATAATGAAGG + Intergenic
1067656756 10:48198492-48198514 CTGCTCAGAATCCATCTTGAGGG - Intronic
1068096939 10:52503317-52503339 CTGAACATAAGCAATATGGAAGG - Intergenic
1069045921 10:63742820-63742842 TTGGTTAGAAGCAATTATGATGG - Intergenic
1069811499 10:71163323-71163345 CTGGTCAGAGGAAATGGTGAGGG + Intergenic
1070180996 10:74014108-74014130 TTTGTTAGAAGCAATAGTGAGGG + Intronic
1071954293 10:90741058-90741080 CTGGTAAGAAGCAATGTCAATGG + Exonic
1073599072 10:104829262-104829284 CTGGTGAGTAGCAAAATTGGAGG + Intronic
1081254688 11:40877727-40877749 AAGAACAGAAGCAATATTGAAGG - Intronic
1089814336 11:121158923-121158945 CTGCTCAGATGCACTGTTGACGG + Intronic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1090035708 11:123247816-123247838 GTGGTCAGTAGGAATATTGAGGG - Intergenic
1094728757 12:33150734-33150756 TTTTTAAGAAGCAATATTGATGG - Intergenic
1097498173 12:60369482-60369504 CTGGTCAGCAGAAATGTTTATGG - Intergenic
1101453444 12:104804195-104804217 CTGGTCAGCAGCAAAATTTTTGG + Exonic
1110675216 13:78234722-78234744 CAGGTAAGAAACAATACTGAAGG - Intergenic
1112181570 13:97087138-97087160 ATGTTCACAAGAAATATTGAGGG + Intergenic
1113676761 13:112213125-112213147 CTTGTTAGAAGCAACTTTGAAGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114629307 14:24148902-24148924 CAGGTAGGAAGCTATATTGATGG + Intronic
1117932711 14:60860804-60860826 CTGGTGAGAAGATATATAGATGG + Intronic
1119088981 14:71762751-71762773 ATGGATAGAAGCAATATTTAAGG + Intergenic
1119581664 14:75789195-75789217 CTGGACAGAAGGAATGTTAATGG - Intronic
1122073861 14:99223111-99223133 CTGGTAAGAAGCACTATCAATGG + Intronic
1122757624 14:103995205-103995227 CTGGTTAGAAGCCATATTCTAGG + Intronic
1124575885 15:30908121-30908143 CTGGTCAGAAGTTATATGTAAGG + Exonic
1129819298 15:78586092-78586114 CTAGACAGAAACAACATTGAGGG - Intronic
1133986113 16:10669530-10669552 ATGGTCAGAAGCAATGAAGAAGG + Intronic
1135313207 16:21421673-21421695 CTGGTCAGCAGCAACATAGCTGG - Intronic
1135366131 16:21853951-21853973 CTGGTCAGCAGCAACATAGCTGG - Intronic
1135445684 16:22517213-22517235 CTGGTCAGCAGCAACATAGCTGG + Intronic
1136152361 16:28359402-28359424 CTGGTCAGCAGCAACATAGCTGG - Intronic
1136194384 16:28641789-28641811 CTGGTCAGCAGCAACATAGCTGG + Intronic
1136210720 16:28755879-28755901 CTGGTCAGCAGCAACATAGCTGG + Intronic
1136309877 16:29400388-29400410 CTGGTCAGCAGCAACATAGCTGG - Intronic
1137031479 16:35528225-35528247 GTGGTCAGAAGCAAGGCTGATGG - Intergenic
1140587001 16:76304708-76304730 TTGGTCAAAAGCAGTTTTGAAGG - Intronic
1140607353 16:76555784-76555806 CAGGACAGAAACAATATGGAAGG + Intronic
1144070193 17:11664563-11664585 CTTCTCAGAAGCAATGCTGATGG - Intronic
1148239337 17:45989714-45989736 CTGATCAGAAGGGATATTAAGGG + Intronic
1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG + Intronic
1155107451 18:22681564-22681586 TTGTTTAGAAGCTATATTGAGGG + Intergenic
1155248284 18:23932242-23932264 CTGGGCGGGAGCAATTTTGAGGG + Exonic
1160338197 18:78061519-78061541 CTGGTAAGAATCAATCTTTAAGG + Intergenic
1160358213 18:78246656-78246678 CAAGTCAGAAGCAAAACTGAGGG - Intergenic
1161654362 19:5504770-5504792 CTGGTCATAAATAATAATGATGG - Intergenic
1163042257 19:14611258-14611280 CTGGTCAAAAATAATTTTGATGG - Intergenic
1163680807 19:18681278-18681300 CTGGCCTGAACCAATCTTGATGG + Intergenic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
926675936 2:15619548-15619570 CTGCTCATAAGCATTAATGATGG - Intronic
928843766 2:35644045-35644067 TTGGACAGAAGCAATGTGGAAGG + Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930474723 2:51867270-51867292 CTGGTCAGAAGCAGTAGAAATGG - Intergenic
931832095 2:66063535-66063557 AGGGTCACAAGCCATATTGAAGG + Intergenic
932865169 2:75334137-75334159 CTGGGCAGCAGGAATATTCAGGG + Intergenic
933314462 2:80699552-80699574 TTGGTCAGAAGCAATGTTGTGGG - Intergenic
938319162 2:130351550-130351572 CTGGTCAGCAGCAGCAGTGAGGG + Intergenic
939825359 2:147008918-147008940 GTGGTGAGATGAAATATTGAAGG - Intergenic
945029050 2:205646758-205646780 GTGGTCAGAAGCATTAGTTAGGG - Intergenic
945795879 2:214363142-214363164 ATGTTCAGAAGAATTATTGATGG - Intronic
946276209 2:218633759-218633781 CTGGTCAGGACCAAAATGGAGGG + Exonic
947037840 2:225879662-225879684 CTGGTGAGAAGGAATATTACAGG + Intergenic
1169645077 20:7801373-7801395 CTGTTTAGAAGGAACATTGAAGG + Intergenic
1169736208 20:8840195-8840217 CTGAACTGAAGCAATATTAATGG + Intronic
1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG + Intergenic
1178789579 21:35687642-35687664 CTGGTCAGCAGAAACAATGAAGG - Intronic
1179466430 21:41578118-41578140 ATGGACAGAAGCAATATTTGAGG - Intergenic
1184111649 22:42399019-42399041 CTGGGCAGAAGCGATATTGAAGG + Intronic
950109010 3:10406785-10406807 CTGGTCAGTGGCAATGTTGATGG - Intronic
950971777 3:17196384-17196406 CTGGTCAGAAGAGACAGTGAAGG + Intronic
952563763 3:34629816-34629838 CTCGTAAGAAGAAATATTCAGGG + Intergenic
952701041 3:36328041-36328063 TTGGTCAGAAGCAATATCATGGG + Intergenic
957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG + Intergenic
962281996 3:134059157-134059179 CTGGGCAGTAGCAAAATAGAGGG - Intergenic
965765869 3:172129267-172129289 CTGGCCAGAAGCTTTTTTGATGG + Intronic
965909136 3:173749650-173749672 TTGGTTAGAAGCACTATTTAAGG - Intronic
966455901 3:180115884-180115906 CTGAACACAAGCAATAATGATGG + Intergenic
968829616 4:2926251-2926273 CAGGACAGAAGCAATATAGGAGG - Intronic
969549009 4:7851931-7851953 CTGGTCAGAAGCAATGGTGTGGG - Intronic
970175350 4:13333803-13333825 CTTATCAAAAGCAATATTCATGG + Intergenic
974486988 4:62518084-62518106 ATGCACAGAAGCAATTTTGATGG - Intergenic
976242031 4:82967825-82967847 CTGATCAGAAGGAAGATTAAAGG - Intronic
977409469 4:96643113-96643135 CTAGTCAGACGTAATATTCATGG + Intergenic
977587461 4:98789661-98789683 CTGGTCAGAAGCAAAGGTCATGG + Intergenic
978906048 4:114007034-114007056 TAGGGCAGAAGCAATATTTAAGG - Intergenic
981649619 4:147040934-147040956 ATGGTCAGAAACATTAATGAAGG + Intergenic
983706712 4:170669586-170669608 CTGAGCAGAAGAAATTTTGAAGG - Intergenic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
992206859 5:74439308-74439330 CTGGTCAGAATGAATTTTCATGG - Intergenic
993105848 5:83599898-83599920 TAGGGCAGAAGCAATATTTAAGG - Intergenic
993744155 5:91575413-91575435 CTGGGCAGAAACAATTTTCAAGG - Intergenic
994083533 5:95733253-95733275 CTGTTCATAAGAAGTATTGATGG + Intronic
994595608 5:101829652-101829674 ATTCTCACAAGCAATATTGAGGG + Intergenic
996781789 5:127194849-127194871 CTGAACAGCAGAAATATTGAAGG - Intergenic
1000739107 5:164943653-164943675 CTGAGCACAAGCAATAATGAGGG - Intergenic
1001164624 5:169352541-169352563 CTGGTGAGAATGGATATTGAAGG - Intergenic
1001711889 5:173785687-173785709 CTGGTAAGAAGCTAAAGTGATGG - Intergenic
1004628810 6:17401829-17401851 CTGTTCTGAAGCAAGATGGAAGG - Intronic
1007736813 6:43987128-43987150 CTGGGCAGAAGCAAAAGAGAGGG - Intergenic
1008736249 6:54548145-54548167 CTAGTCAAAAGTAATTTTGAAGG + Intergenic
1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG + Intronic
1010253087 6:73728619-73728641 ATGGTCAGCAGCAATATTTAGGG - Intronic
1012593937 6:101018770-101018792 CAGGTGAGAAGCAATATCAAAGG + Intergenic
1020523607 7:9228050-9228072 CAAGACAGAAGCAATATTTAAGG - Intergenic
1031869995 7:127081038-127081060 ATGGTCAGCAGCGATATTTAAGG + Intronic
1033793857 7:144824029-144824051 CTGGAAAGAAGAAATATTTAAGG - Intronic
1040708687 8:50161801-50161823 CTGGATAGCAGCAATATTTAAGG + Intronic
1040711200 8:50191307-50191329 TTCATCAGAAGCAGTATTGAAGG + Intronic
1043583602 8:81740677-81740699 TTATTCAGAAGGAATATTGAGGG - Intronic
1044766961 8:95586798-95586820 CTGGTAAGAAGCAATCTCAATGG - Intergenic
1045161835 8:99556527-99556549 CTGTGCAGTACCAATATTGATGG - Exonic
1046223081 8:111240580-111240602 CAGTTCACAAGCAATATTGGAGG + Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1047340114 8:123972937-123972959 CTGATCAGACAGAATATTGAGGG + Intronic
1048078394 8:131098180-131098202 CTGGCCAGAAGCAACACTGGAGG + Intergenic
1048407275 8:134136595-134136617 CTGATGAGAATGAATATTGAAGG - Intergenic
1049303770 8:141886259-141886281 CTGGAGAGATGAAATATTGATGG + Intergenic
1050598299 9:7225949-7225971 CAGTTTAGAAGCAATATAGAGGG + Intergenic
1055677348 9:78678285-78678307 CTGTTCATAGGCATTATTGAGGG - Intergenic
1056113813 9:83422417-83422439 TTGATCAGCAGCAATATTTAAGG + Intronic
1057845695 9:98520756-98520778 CTGGCCTTCAGCAATATTGATGG - Intronic
1187087079 X:16051756-16051778 CAGGTTAGAAGCAAGATGGAGGG + Intergenic
1192622573 X:72693824-72693846 CATGGCAGAAGCAATATTCAAGG - Intronic
1195386156 X:104315070-104315092 CTGGTCTGAAGTATTAATGAAGG - Intergenic
1196734557 X:118973213-118973235 TTGTTCAGAAGCAAAAATGATGG + Intergenic
1199226519 X:145381875-145381897 CTTGTCAACAGCAATCTTGAAGG - Intergenic