ID: 1152063505

View in Genome Browser
Species Human (GRCh38)
Location 17:78096783-78096805
Sequence CTGGAGAAGAAGAGCGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 576}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152063505_1152063508 6 Left 1152063505 17:78096783-78096805 CCATCCTCGCTCTTCTTCTCCAG 0: 1
1: 0
2: 3
3: 52
4: 576
Right 1152063508 17:78096812-78096834 GCTTTCTTCACAGAATTGAAAGG 0: 1
1: 0
2: 3
3: 26
4: 260
1152063505_1152063509 7 Left 1152063505 17:78096783-78096805 CCATCCTCGCTCTTCTTCTCCAG 0: 1
1: 0
2: 3
3: 52
4: 576
Right 1152063509 17:78096813-78096835 CTTTCTTCACAGAATTGAAAGGG 0: 1
1: 2
2: 3
3: 34
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152063505 Original CRISPR CTGGAGAAGAAGAGCGAGGA TGG (reversed) Intronic
900467171 1:2831460-2831482 CTGGAGAGGAAGAGCAAGCTGGG - Intergenic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901404726 1:9038533-9038555 CTGGAGCAGACAAGCTAGGACGG + Intronic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902256921 1:15195526-15195548 CTAGAGAAGATGAACGAGGGTGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
903700067 1:25240416-25240438 CTGGGGAAGAAGAGGGACTAGGG - Intergenic
904046699 1:27613351-27613373 CTGGAGAAGATGGGGGAGCAGGG + Intronic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904441443 1:30534494-30534516 CTGGAGAGGAAGAGCATGCAGGG + Intergenic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905274148 1:36806244-36806266 CTGGTGAAGAACAACGAGGAGGG - Exonic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906373705 1:45276476-45276498 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
906403393 1:45521955-45521977 CCGGAGGAGGAGAGAGAGGAGGG + Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906609125 1:47190041-47190063 CTGGAGGAGAGGAGCTAGGAAGG + Exonic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907460866 1:54604691-54604713 CTGCAGAAGAACAGAGAGGGAGG - Intronic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
907649071 1:56276148-56276170 CTGGAGACGAACAGAGAGGAGGG - Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907856916 1:58312651-58312673 CAGAATAAGAAGAGCCAGGAAGG + Intronic
908122296 1:60997634-60997656 CTGGAGAAGAATTGGGAGTAGGG + Intronic
908439204 1:64136555-64136577 CTGGAGATGAAGACCCAAGATGG - Intronic
908830593 1:68174642-68174664 CTGGAGAAGAAGAGCAGAAAGGG - Intronic
908992596 1:70111230-70111252 CTGAAGAAGAAAAGAGTGGATGG - Intronic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
911346819 1:96706742-96706764 CTGGAGTGGAGGAGTGAGGAGGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912194228 1:107378634-107378656 CAGGAGAAGAATGTCGAGGAAGG + Intronic
915864903 1:159488907-159488929 CTGAAGAAGACAAGAGAGGATGG + Intergenic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921798933 1:219379931-219379953 GTGGTGAAGAAGAGGCAGGAAGG + Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924454790 1:244210799-244210821 CTGGAGAAGAGTGGCTAGGATGG - Intergenic
924632311 1:245752548-245752570 CTGGAAGAAAAGAGCGAGGAAGG - Intronic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071489952 10:86129488-86129510 CTGGAAGAGAAGGGCTAGGATGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071874526 10:89830191-89830213 CTGGCGAAGAAGTGCATGGAAGG - Intergenic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072806268 10:98425641-98425663 CTGGAGAAGAAGCTGAAGGAAGG - Exonic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074599863 10:114902572-114902594 CTGGAGAAAAAAATCCAGGAAGG + Intergenic
1074727898 10:116333043-116333065 CTAGAAAACAAGAGCAAGGAAGG - Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075396680 10:122132820-122132842 CTGCAGGAGAAAAGAGAGGAGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076405172 10:130206952-130206974 CTGCAGAAGACCAGAGAGGAAGG - Intergenic
1076590344 10:131578213-131578235 CTGCAGAACAAGAGGAAGGATGG - Intergenic
1076854618 10:133109693-133109715 CTGGAGAATATGAACCAGGAGGG - Intronic
1076934000 10:133555439-133555461 CTGGACAGGAAGAGGTAGGATGG + Intronic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1078392078 11:10944009-10944031 CTAGAGAAGTAGAGTGAGGGTGG - Intergenic
1078403131 11:11045231-11045253 CTAGAGAAGAAGAGGCAGGTAGG - Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079140836 11:17808400-17808422 CAGGAGCAAAAGAGCGAGCAGGG + Intronic
1080748687 11:35132293-35132315 CTGGAGAAGATCTGGGAGGATGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082011001 11:47449417-47449439 CGGGGGAAGGAGAGCGAGGCTGG + Intergenic
1082681971 11:56185132-56185154 CTAGAGGAGAAGAGAGAGCAAGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1084393236 11:68892097-68892119 GTGGAGAAGGGGAGCGAGGTGGG + Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084705292 11:70812818-70812840 CTGGCCAAGAACAGCCAGGAGGG + Intronic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084768677 11:71328628-71328650 CTGGAGCAGAGCAGCAAGGAAGG - Intergenic
1084839617 11:71834583-71834605 CTGGAGAAGAAAACACAGGATGG + Intronic
1085164774 11:74388795-74388817 CTGGTGAAGAATAGACAGGAAGG - Intronic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1088965578 11:114717748-114717770 GTCGAGAAGATGAGGGAGGAGGG - Intergenic
1089061654 11:115630722-115630744 CTGGAAAACAAAAGAGAGGAGGG - Intergenic
1089283609 11:117391712-117391734 CTGGAGTAGAAGAGGGAGTATGG - Intronic
1089462128 11:118659572-118659594 CGAGAAAAGAAGAGCCAGGAAGG - Intronic
1090085861 11:123650557-123650579 CTGGAGAAGAAGGGCAGAGAAGG + Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1091053400 11:132395718-132395740 CTGGAAGAGAAGAGAGATGATGG + Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091621953 12:2095624-2095646 CTGGAGGAGAAGGGCTAGGCAGG + Intronic
1091684833 12:2554368-2554390 TTCTTGAAGAAGAGCGAGGAGGG - Intronic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1092083854 12:5739677-5739699 CTGGAGAAGTAAAGTAAGGATGG + Intronic
1092167890 12:6354297-6354319 CTGAAAAACAAGAGCAAGGAAGG + Intronic
1092448458 12:8580213-8580235 GTGGACTAGAAGAGCCAGGAAGG + Intergenic
1094227469 12:28062098-28062120 TTGGATAGGAAGAGCCAGGATGG - Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097951360 12:65432520-65432542 CAGGATTAGAAGAGCTAGGAGGG - Intronic
1098325312 12:69296178-69296200 CTGGAGAAGATATGGGAGGAAGG + Intergenic
1100184793 12:92127646-92127668 GGGGAGAAGAGGAGGGAGGATGG + Intronic
1100226097 12:92557291-92557313 CTTGAGGAGATGAGCGAAGAAGG + Intergenic
1100263039 12:92950595-92950617 CTGGGCAACAAGAGCCAGGAAGG + Intergenic
1101436718 12:104670355-104670377 CTGGAATAGAAAAGCGGGGAAGG - Intronic
1101605278 12:106243746-106243768 CTGGAGAACAAGAGACAGGTGGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102765970 12:115433272-115433294 GGGGAGAAGAAGGGGGAGGAAGG + Intergenic
1102772038 12:115486447-115486469 CTAGAGAAGAGCAGAGAGGAGGG + Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1103403051 12:120656123-120656145 GTGGTGCAGACGAGCGAGGAGGG + Intronic
1103948174 12:124538468-124538490 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1104325705 12:127795064-127795086 CTGGAGGAGAAGAGCATAGAAGG - Intergenic
1104751169 12:131240079-131240101 CTGGAGAGAAAGATCTAGGAAGG + Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1108701075 13:52944643-52944665 CTGGGTAAGGAGAGCAAGGAGGG + Intergenic
1110382511 13:74870031-74870053 CTGGAGAAGAAGAGAGATAGGGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112302068 13:98239740-98239762 CCGGAGGAGATGAGCGGGGAGGG + Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113460411 13:110478542-110478564 CTGGAGCAGAGGAGCGGGGAGGG + Intronic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1114550726 14:23531443-23531465 CTGGAGAATAAGAGCTGGGCAGG - Intronic
1114913863 14:27236776-27236798 CAGGAGAATAAGAGCGAGCAAGG - Intergenic
1115273551 14:31581314-31581336 CTGGGGATGAATAGTGAGGATGG - Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116739498 14:48736144-48736166 CAGGAGAAGGAGAGCAAGGTGGG + Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118496297 14:66311119-66311141 CTTGAGAAAAAGAACCAGGAAGG + Intergenic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120708599 14:87770754-87770776 CTGGAGAGCAAGAGCCAGGTGGG - Intergenic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1122290665 14:100678758-100678780 CTGGAGCAGGAAAGCCAGGAGGG + Intergenic
1122389017 14:101367795-101367817 GTGGAGAAGAAGAGCGGGTGAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123173805 14:106399155-106399177 CTGGAGCAGGCGAGCCAGGATGG + Intergenic
1123182058 14:106480429-106480451 CTGGAGCAGGCGAGCCAGGATGG + Intergenic
1202944847 14_KI270726v1_random:16301-16323 CTGGAGCAGGCGAGCCAGGATGG - Intergenic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124819874 15:33034247-33034269 CTGGAGAAGATGACCGTGGGTGG - Intronic
1124847813 15:33309389-33309411 CAGGAGAAGAAAAGAGTGGATGG + Intergenic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1127025532 15:54801154-54801176 CAGGAGCAAAAGAGAGAGGAGGG + Intergenic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127960042 15:63884058-63884080 TTGGAGAACAAGAGAGATGAAGG + Intergenic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128476555 15:68001694-68001716 CTGGAGCACAAGAGAGATGAGGG + Intergenic
1128931064 15:71705291-71705313 GTGGAGAGGAAGAGCAAGGCGGG + Intronic
1129151855 15:73694145-73694167 CTGGAGATGAAGCACGTGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1132078654 15:98845546-98845568 CGAGAGAAGAGGAGAGAGGAGGG - Intronic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1132985303 16:2763315-2763337 TTGGAGAAGAGGAGCCAGAATGG - Exonic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1136040226 16:27572707-27572729 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1136074847 16:27809930-27809952 CTGGAGGAGAAGATGGGGGAAGG + Intronic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136778292 16:32882959-32882981 CTGGAGGAGAGGAGAGAGGCTGG - Intergenic
1136892328 16:33978555-33978577 CTGGAGGAGAGGAGAGAGGCTGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138105762 16:54286457-54286479 GGGGAGAGGAAGGGCGAGGAGGG - Exonic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1141583179 16:85014560-85014582 CAGAACAAGAACAGCGAGGAAGG + Intergenic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1203080714 16_KI270728v1_random:1145068-1145090 CTGGAGGAGAGGAGAGAGGCTGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1144093637 17:11880645-11880667 GTGGAGAGGAAAAGAGAGGAAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144773779 17:17773781-17773803 CAGGGGAAGAAGGGCTAGGAGGG - Intronic
1144852067 17:18248884-18248906 CTGGACAAGAAGGGGCAGGAAGG + Intronic
1145979387 17:29002861-29002883 CTGGAGGAGAAAAGAGAGGAAGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146955233 17:36933397-36933419 CTGGAACCGAAGAGAGAGGAGGG + Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1148105932 17:45118871-45118893 CTGGAGGACCAGGGCGAGGAGGG - Exonic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148768519 17:50053493-50053515 CTGGAGAAGAGGAGCCAGCCAGG - Intergenic
1150069570 17:62139683-62139705 CTGGAACAGATGAGCCAGGAGGG - Intergenic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1150283143 17:63940886-63940908 CCGGAGGAGAAGGGCGAGGCAGG - Exonic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1151886679 17:76926816-76926838 CTGGAGAAGGAAAGAGAGGGAGG - Intronic
1151993917 17:77596710-77596732 CTGGAGAAGACGAGGTAGCAGGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1154005390 18:10523266-10523288 GGGGAGAAGAAGAGAGAGAATGG - Intergenic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1155503151 18:26506685-26506707 CTGGAGAAGAGGAGGTAGAAAGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1157300768 18:46477506-46477528 CTGGACAAGAAGCGGGGGGATGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1159483428 18:69021727-69021749 CTGGAGTAGATGGGCAAGGACGG + Intronic
1159946497 18:74447914-74447936 CTGGAGAAGAGGAGGGACCAAGG + Intronic
1160727691 19:624879-624901 CTGGAACAGATGAGCCAGGAGGG - Exonic
1160932638 19:1577938-1577960 CTGTAGAGGACGAGCGTGGAGGG + Exonic
1161307387 19:3575639-3575661 CAGGAGAAGAAGATCAAGAAAGG + Exonic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163676007 19:18655659-18655681 CTGGACATGGAGAGCCAGGATGG + Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1165007223 19:32817210-32817232 CTGGAGATGGATAGCGATGATGG - Intronic
1165172128 19:33901082-33901104 CTGGACAAGAACAGCTGGGAAGG + Intergenic
1165960306 19:39528686-39528708 TTGGAAAAGAAGAGCAATGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167027099 19:46928539-46928561 CTGGAGCCAAACAGCGAGGAGGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1168104229 19:54156826-54156848 CTGGGGAAGAAGAGACAGCACGG - Exonic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926133542 2:10320430-10320452 CTGGAGCAGAAGGGAGAGCAGGG - Intronic
926171063 2:10552925-10552947 CTGGAGAAGACGGGCACGGATGG + Intergenic
926378943 2:12264723-12264745 CAGGAGCAAGAGAGCGAGGAAGG + Intergenic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
928383091 2:30838087-30838109 CTGGAGATGAACAGTGATGATGG + Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
928902011 2:36329638-36329660 CTGGAGAAGAAGAGGGGGCTGGG - Intergenic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
931523690 2:63128565-63128587 CTGGAGATGGAGAGCGGTGATGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932127600 2:69157963-69157985 CTGGAGAAGTGGGGCCAGGATGG - Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
933770454 2:85740926-85740948 CCAGAGAAGAGGAGCCAGGAAGG + Intergenic
934552256 2:95269638-95269660 CTGGTGAGGAAGGGCGAGGTGGG - Intergenic
935231744 2:101104410-101104432 CTGGAGAAGAAGAACAAAGTTGG + Intronic
936370451 2:111898507-111898529 CTGGAGGAGAGGAGCGGGCAGGG - Exonic
936509063 2:113131022-113131044 CTGGGGAAGAACAGAGGGGAGGG - Intronic
937062070 2:118988190-118988212 CTGGAGGTGAGGAGCTAGGAAGG + Intronic
937209849 2:120261373-120261395 AAGGAGAAGAAGGGCGTGGAAGG + Intronic
937218202 2:120326031-120326053 GAGGAAAAGTAGAGCGAGGAGGG + Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
940639786 2:156333785-156333807 CTGGACAAGAAAAGCGAAGCGGG + Intronic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
941728898 2:168893899-168893921 CTGGAGATGAATAGCGGTGATGG - Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
943266490 2:185738841-185738863 CTAGAGAAGGAGAGCGGGGCGGG + Exonic
943347983 2:186762666-186762688 CTGGAGAAGAGTCGCCAGGAAGG + Exonic
944498056 2:200328596-200328618 CTGGAGAACAACCGCGAGGGAGG - Intronic
945251494 2:207769230-207769252 CGGGAGAAGAACAGGGAGAAAGG + Intronic
945520819 2:210824945-210824967 CAGGAGTAGAAGACCTAGGAAGG - Intergenic
945935985 2:215903160-215903182 TTGGAGAAGAAGAGGGTGAAGGG - Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946061843 2:216949339-216949361 CTGGAGAAAAAGTGCTAGAAGGG + Intergenic
946173527 2:217909148-217909170 CTGGAAAAGAAGGGAGAGGCTGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947169219 2:227294467-227294489 CTGGAAATGAAGAGAGGGGAAGG - Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947977197 2:234377063-234377085 CAGGACAAGAAGAGCAGGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948055404 2:235006608-235006630 CTGGCAAAGCAGAGCGAGGGGGG - Intronic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948587462 2:239028238-239028260 CAGGAGAAGAATCCCGAGGATGG - Intergenic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1168760853 20:348365-348387 AGGGAAAAGAAGAGCGGGGAAGG - Intronic
1169138604 20:3213404-3213426 CTGGACAAGAAGAGCAAGTGTGG - Intronic
1170131235 20:13022528-13022550 CTGGAGAAGCTGGGCCAGGAGGG + Intronic
1170215912 20:13891057-13891079 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171282807 20:23915245-23915267 CAGGATAAGAAGGGCAAGGAGGG - Intergenic
1171986464 20:31664816-31664838 GTGGAGCAGAAGAGAGAGGGAGG + Exonic
1172063977 20:32206888-32206910 ATGGGAAGGAAGAGCGAGGATGG + Intronic
1172199958 20:33118436-33118458 CTGGAGAAGAGGAGTGAAGCAGG + Intergenic
1172272889 20:33664310-33664332 CTGGGTAAGAACAGCCAGGATGG + Intronic
1172320053 20:33989326-33989348 ATGGAAAACAAGAGCAAGGAAGG - Intergenic
1172413085 20:34740999-34741021 CTGGAGAAGACGTACAAGGAGGG + Exonic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1174338564 20:49882224-49882246 GTGGAGAAAATGAGCGAGCACGG - Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174588845 20:51629198-51629220 CTGAAGATGAAAAGCGAGAAGGG + Intronic
1174735195 20:52959601-52959623 CTGGAGAAGAGGGGCTTGGACGG - Intergenic
1175891491 20:62317969-62317991 GTGGGGAAGAAGAGAAAGGAAGG + Intronic
1176169833 20:63691785-63691807 CGGCAGAAGAACCGCGAGGAGGG + Exonic
1178730230 21:35095231-35095253 CAGGAGCAAAAGAGAGAGGAGGG + Intronic
1178810936 21:35880800-35880822 CTGGTGGAGAAGAGGGGGGAAGG - Intronic
1179674823 21:42974410-42974432 CTGGGGGAGGAGAGCGAGGGCGG - Intergenic
1179774050 21:43648301-43648323 CTAGAGAAGATGACCAAGGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181602107 22:23958814-23958836 CTGGAGATGGAGGGCGAGGCTGG - Intronic
1181606403 22:23982493-23982515 CTGGAGATGGAGGGCGAGGCTGG + Intronic
1182550565 22:31098818-31098840 CTGGAGAAGGAGGGCGCGGCCGG + Exonic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183732690 22:39627567-39627589 CTGCTGAAGAGGGGCGAGGAAGG + Intronic
1183954542 22:41371492-41371514 CTGGAGATGGAGAGAGAGGGGGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1185178375 22:49344831-49344853 CTGGAACAGAAGCGGGAGGAGGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950746879 3:15097774-15097796 CTGTAGAAGACCACCGAGGAGGG + Intronic
950842492 3:15980733-15980755 CTGGAGATGAATAGTGATGATGG + Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952419579 3:33118973-33118995 TGGGAGAAGAAGAGGGAGAAAGG - Intronic
953638563 3:44684631-44684653 CTAGAGAAGAAAAGCCAGAAAGG - Intergenic
953728956 3:45428606-45428628 CTGGAGATGAAGAGTGATAATGG - Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
953972149 3:47355986-47356008 ATTGAGAAGAACAGCCAGGACGG - Intergenic
954211886 3:49102414-49102436 CTGGAGAAGAAGTTCAAGGTAGG - Exonic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
954979015 3:54726461-54726483 CTGGGCAAGAAGAGCAAGGCTGG + Intronic
956110043 3:65861142-65861164 CTGGAAAACTAGAGCGAGGGGGG - Intronic
956181941 3:66525291-66525313 CAGGTAAAGAAGAGCCAGGAGGG - Intergenic
956723957 3:72141834-72141856 CTGGAGAAGAAGAGCCTGAGGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961315930 3:126035676-126035698 GTGGAGAAGAAGAGCCTGGCTGG + Intronic
961345475 3:126260747-126260769 TGGGAGAAGAACAGGGAGGAAGG - Intergenic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
963963582 3:151338860-151338882 CTAGAGAACAAAAGAGAGGATGG + Intronic
964211726 3:154235810-154235832 CTGGAGAAGAGGAGGAAGAAGGG - Intronic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965809106 3:172574341-172574363 CTGGACCAGATGAGAGAGGATGG + Intergenic
965817870 3:172655507-172655529 CTGGAGAAGGAGAGAGAGTTGGG + Intronic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968477743 4:820392-820414 CTGGGCAAGAAGAGAGAGGCAGG + Intronic
968624311 4:1619625-1619647 CTGGAGATGAAGGGCGGGGGTGG - Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969207273 4:5656327-5656349 CTCGAGAAGAAGTGAAAGGAGGG - Intronic
969330553 4:6471698-6471720 CTGGAGAAGAAGAGGGACCCGGG - Intronic
969581899 4:8070766-8070788 CTGGGGAAGGAAAGAGAGGAGGG + Intronic
969651256 4:8469604-8469626 CTGGAGATGGAGAGCGGGGATGG + Intronic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970750930 4:19359977-19359999 CCAGACAAGAAGAGTGAGGAAGG + Intergenic
970846898 4:20551079-20551101 CTGGAAAATAAGAGCCAGAAGGG - Intronic
971285274 4:25283091-25283113 CTGGACAAGAAGAACGAAGTTGG + Intergenic
972789489 4:42357308-42357330 GGGGAGAAGAAGGGAGAGGAGGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
973636490 4:52865913-52865935 CTGGAGCAGAAGGGCCAAGAGGG + Exonic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975391464 4:73822884-73822906 AGGGAGAAGAAGAGGGAGAAAGG + Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977548954 4:98419996-98420018 CTGGAGAAAAAGAGAGACTATGG - Intronic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
982508726 4:156253049-156253071 CTGGAGTAGAAAATCAAGGACGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983891543 4:173034850-173034872 CTGGAAAAGAAGCTCCAGGAGGG + Intronic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986353423 5:6902146-6902168 CAAGAGAAGAAGAGCAAAGAGGG + Intergenic
986727275 5:10608389-10608411 CTGAAGGGGAAGAGCAAGGAAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
995126622 5:108583298-108583320 CTAGAGAATAAAAGGGAGGAGGG + Intergenic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
995718208 5:115101611-115101633 CTGGAGCATAAGTGAGAGGAAGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
999178365 5:149648382-149648404 CAGGAGGAGGAGAGCAAGGAGGG - Intergenic
999857332 5:155608929-155608951 CTGGAGAAGAAGAGTGGGATGGG + Intergenic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000559393 5:162767158-162767180 CAGGAGCATATGAGCGAGGAGGG + Intergenic
1001697450 5:173682330-173682352 CTGGAGATGAACAACGGGGATGG + Intergenic
1002041984 5:176521241-176521263 CTGGAGAAGACGGGAGAGGAGGG + Intergenic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004632627 6:17436561-17436583 TTGGAGAGGAAGAGAGAGGGAGG + Intronic
1006450528 6:34103376-34103398 CTGGAGAAGAATAGTGGGTACGG + Intronic
1006572474 6:35017308-35017330 GGAGAGAAGAAGAGAGAGGAAGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1008416270 6:51244424-51244446 ATGGAGAAAAAGAGCAATGAAGG - Intergenic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1010696802 6:78985372-78985394 CCGAAGAAGAAGAGAGAGCATGG - Exonic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011402787 6:86982040-86982062 CTGGAGAATAAGAACCAGGTGGG + Intronic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014831195 6:126104760-126104782 TGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017846949 6:158266890-158266912 CTGGAGATGGATAGCGATGATGG - Intronic
1018652033 6:165999994-166000016 CTGGAGACTGAGAGCAAGGAGGG - Intergenic
1019286582 7:226294-226316 CTGGAGAAGACCGGCTAGGAGGG + Intronic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020049514 7:5072515-5072537 CTGGAGGGGAGGGGCGAGGAAGG + Intronic
1020484076 7:8699460-8699482 CTGCAGAAGAATAGCTAAGAAGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021957466 7:25840344-25840366 CTGGAGAAGAGGTGTGAGGGAGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022315158 7:29238877-29238899 CTGGAGAAAATGAGCAAGGCGGG + Intronic
1022436238 7:30388548-30388570 CTGGAGAACACGTGCCAGGATGG + Intronic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032412951 7:131712651-131712673 CTGGAAAAGAAGAGCAAAGTTGG - Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032663788 7:134015063-134015085 CTGGAGAAGATGTTCAAGGAAGG + Intronic
1033159287 7:138981803-138981825 CGGGAGAGGAGGAGCGAGGGAGG - Intergenic
1033553228 7:142466346-142466368 TTGGAGGAGAAAAGCCAGGAAGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034558374 7:151864046-151864068 CTAGAGGAGAGGAGAGAGGAGGG + Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035015578 7:155762918-155762940 CTGGGAAAGAACAGCAAGGACGG - Intronic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035307872 7:157944990-157945012 CTGGAGCAGATGAGCGATCATGG - Intronic
1035811240 8:2493049-2493071 GTGGAGAAGAAGGGAGATGAAGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036278134 8:7374528-7374550 CTGGAGAAGAAAACACAGGATGG + Intronic
1036343388 8:7937363-7937385 CTGGAGAAGAAAACACAGGATGG - Intronic
1036602265 8:10272318-10272340 CTGGAGAACAAGAGAGCTGATGG + Intronic
1036838727 8:12098125-12098147 CTGGAGAAGAAAACACAGGATGG - Intergenic
1036860515 8:12344369-12344391 CTGGAGAAGAAAACACAGGATGG - Intergenic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1040453686 8:47574745-47574767 CTTGAGAAGAGGAGAGGGGAGGG + Intronic
1040581954 8:48705533-48705555 GTGGAGAAAAACAGCCAGGAGGG + Intergenic
1041340959 8:56844962-56844984 CTGCTGAGGAAGAGCCAGGAGGG + Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041602146 8:59731749-59731771 GGGGAGAAGAAGAGGGAGGGTGG + Intergenic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1044182072 8:89208631-89208653 CTGGAGAAAAACACCTAGGAAGG + Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1044850645 8:96424197-96424219 CTGGAGAAGAAGAGGGTGAGGGG + Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1046632727 8:116637484-116637506 CTGGAGTAGGAGAGAGAGAAAGG - Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1049469240 8:142768140-142768162 GGGGAGAAGAGGAGAGAGGAAGG + Intronic
1049540579 8:143207072-143207094 CTGGAGAAGAGGAGCGGGTCTGG + Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1051001983 9:12293284-12293306 CTGGAAAAGAAAAGAGTGGAGGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052324782 9:27205936-27205958 CTGGAGAAGAAGGGCCAGCAAGG + Intronic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055194145 9:73566338-73566360 ATGGAAAAGAAGAGATAGGAAGG - Intergenic
1055729308 9:79264316-79264338 CTGGAAAAGGAGAGAGAGAAAGG - Intergenic
1056463057 9:86826647-86826669 GGGCAGAAGAAGAGAGAGGAAGG - Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057318801 9:93992644-93992666 CTGGAGGAGAAGGGACAGGAGGG - Intergenic
1057396917 9:94688845-94688867 CTGGGGAAGAGGGGCAAGGATGG + Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057931361 9:99196291-99196313 GTGGAGAAGAAGAGAGCAGAAGG - Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1060827453 9:126695173-126695195 CTGGAGGAGGAGACCGAGGCTGG - Intronic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1061022667 9:128026365-128026387 CTGGGGCAGACGAGAGAGGAAGG + Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061298209 9:129688588-129688610 CTGAAGGAGAACAGCCAGGAGGG + Intronic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1061738401 9:132679525-132679547 CTGCAGGAGAGGAGCAAGGAAGG + Exonic
1185528793 X:800627-800649 CTGGAAAAGATGTGCGGGGATGG + Intergenic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188538080 X:31219404-31219426 GTGGAGAATAAGAGAGAGGGCGG - Intronic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189120914 X:38393978-38394000 CTAGAGAATAAGAGAGAGGCAGG - Intronic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192140651 X:68644928-68644950 CAGGACAAGACGAGAGAGGAAGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG + Intergenic
1193463547 X:81818491-81818513 CTTGAGAAGAGGAGAGAGTAAGG - Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1199074024 X:143510038-143510060 CTGGAGAAGATGAGAGAATAGGG - Intronic
1199579498 X:149347189-149347211 CTCAAGAAGAAAAGGGAGGAAGG - Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200210555 X:154345053-154345075 CGCGGGAAGAACAGCGAGGAGGG + Intergenic
1200220297 X:154387039-154387061 CGCGGGAAGAACAGCGAGGAGGG - Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202240924 Y:22768534-22768556 TAGGAGAAAAAGAGCAAGGATGG + Intergenic
1202393910 Y:24402277-24402299 TAGGAGAAAAAGAGCAAGGATGG + Intergenic
1202476875 Y:25267815-25267837 TAGGAGAAAAAGAGCAAGGATGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic