ID: 1152064352

View in Genome Browser
Species Human (GRCh38)
Location 17:78102258-78102280
Sequence CAGAGTCACCACGGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152064346_1152064352 4 Left 1152064346 17:78102231-78102253 CCGGGCTGGTGGGAAGATCCAAA 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 161
1152064344_1152064352 8 Left 1152064344 17:78102227-78102249 CCTCCCGGGCTGGTGGGAAGATC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 161
1152064345_1152064352 5 Left 1152064345 17:78102230-78102252 CCCGGGCTGGTGGGAAGATCCAA 0: 1
1: 0
2: 1
3: 28
4: 203
Right 1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152064352 Original CRISPR CAGAGTCACCACGGGGAAGT GGG Intronic
900985344 1:6069902-6069924 CAGAGCCCACTCGGGGAAGTGGG + Intronic
903296049 1:22343684-22343706 CAGAGTGGGCAAGGGGAAGTGGG + Intergenic
903336420 1:22627490-22627512 CAGAGTCACCTGGGGGAGCTGGG - Intergenic
904471441 1:30739033-30739055 CAGCGTCATCAGGGGGAACTTGG + Exonic
904948615 1:34217644-34217666 CTGAGTCTCCATGGGCAAGTTGG - Intronic
905586410 1:39122802-39122824 CAGAGTCACAATGTTGAAGTGGG + Intronic
907608986 1:55848575-55848597 CAGAGTCAAAGTGGGGAAGTAGG + Intergenic
908574176 1:65441665-65441687 CAGAATGACGAAGGGGAAGTGGG + Intronic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
913445667 1:118948093-118948115 CTGAGTCACCACTGGGGAGATGG - Intronic
914327192 1:146630938-146630960 CAGAGTCACAATCAGGAAGTAGG - Intergenic
919597768 1:199585573-199585595 GGGAGTCACAATGGGGAAGTTGG - Intergenic
922184789 1:223264739-223264761 CACAGTCCCCACCGGGAAGGAGG + Exonic
922460840 1:225813360-225813382 CAGAGTCTCCAAGGGGCTGTGGG + Intronic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
1062854088 10:770587-770609 CAGAGGCACCTCTGGGAAGTGGG + Intergenic
1062979205 10:1707877-1707899 CAGAGTCAGCACTGGTCAGTGGG + Intronic
1063558422 10:7102970-7102992 CTGAGTCACCACCTGGAAGAAGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064691968 10:17927567-17927589 CAGATTCACCAGCAGGAAGTGGG + Intergenic
1071563645 10:86660681-86660703 CAGAGTCAATGGGGGGAAGTGGG + Intronic
1072513913 10:96158075-96158097 CAGAGTCACCCCGAGGTATTAGG + Exonic
1074696622 10:116055667-116055689 CAGAATCATCAAGCGGAAGTGGG - Intergenic
1074735146 10:116423399-116423421 CAGAGTGAGCAGGGGGAAATCGG + Intergenic
1075598944 10:123753125-123753147 CAGAGACCCCCCGGGGAAGAAGG + Intronic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1076353108 10:129832178-129832200 CAGTTTCACCACCTGGAAGTGGG + Intergenic
1076471330 10:130720631-130720653 AAGAACCACCATGGGGAAGTTGG - Intergenic
1077522329 11:3043676-3043698 CACACTGATCACGGGGAAGTTGG + Intronic
1078003551 11:7516123-7516145 CAGAATCACCTGGGGGAACTTGG - Intronic
1079339176 11:19597982-19598004 CAGAGAGACCACGGGGCAGCTGG + Intronic
1081323207 11:41716216-41716238 CAGATTCACCACTGGTAACTTGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083363575 11:62128152-62128174 CAGAGCCACCATGGGGACGACGG + Exonic
1084105184 11:66976208-66976230 CAGAGTCACGCTGGGGAAGATGG - Exonic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085942303 11:81219821-81219843 CAGACTCATCCCGGGGAAGTTGG + Intergenic
1088847745 11:113682119-113682141 CAGAGTGACCAGGGGAAACTGGG + Intergenic
1091796650 12:3301132-3301154 AGGAGTCACCACTGGGAACTGGG - Intergenic
1095596241 12:43961798-43961820 CATACTCACCACTGGGAAGAAGG - Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1101716981 12:107319971-107319993 CAGGGTCTCCACGGTGAACTTGG - Exonic
1102028014 12:109724441-109724463 AAGAGGCACCACTGGGAAGAAGG - Intronic
1104775542 12:131388217-131388239 CAGACTCACCAGGGGGACCTGGG + Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1111996920 13:95174664-95174686 TAGAGTCGCCGCGGGGAAGGAGG - Intronic
1112437328 13:99399689-99399711 CAGAGTTCCCAGGGGGCAGTAGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1118364167 14:65080088-65080110 TAGAGACACCACGGGAAAGATGG + Intronic
1125524715 15:40367725-40367747 CAGATTGACGAAGGGGAAGTAGG - Exonic
1129333393 15:74838981-74839003 GAGAGTCCCCATGAGGAAGTGGG - Intronic
1131015847 15:89057424-89057446 CACAGTGACCACTGGGAAGTTGG + Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1137515148 16:49137058-49137080 GAGAGACAGCCCGGGGAAGTAGG + Intergenic
1138112542 16:54336511-54336533 CAGAGACACTAGGGGCAAGTGGG + Intergenic
1139149863 16:64369443-64369465 CAGATTGACCATGGGGAAGCTGG - Intergenic
1140006368 16:71080001-71080023 CAGAGTCACAATCAGGAAGTAGG + Intronic
1141613621 16:85197861-85197883 CAGGGTCCCCACGGGGCTGTTGG + Intergenic
1142500947 17:332693-332715 AAGATTCCCCACGGGGTAGTCGG + Intronic
1142673717 17:1500234-1500256 GAGAGTCACCAAGGTGGAGTGGG - Intronic
1142993986 17:3750372-3750394 CAGAGTGCCCACGGTGATGTCGG + Exonic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143563102 17:7706603-7706625 CACAGTCTCCCCAGGGAAGTAGG - Intronic
1143888363 17:10083805-10083827 CAAAGACACCACGCAGAAGTGGG + Intronic
1145980653 17:29009430-29009452 CAGAGTCCCTGCTGGGAAGTAGG + Intronic
1152022617 17:77788581-77788603 CAGAATGACCACGTGGATGTGGG + Intergenic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1152107187 17:78337507-78337529 GTGAGTCACCATGGGAAAGTTGG + Intergenic
1152408057 17:80108594-80108616 CCAACTCACCAGGGGGAAGTGGG - Intergenic
1152525282 17:80884839-80884861 CAGAGTGGCAACGGGGAAGGAGG - Intronic
1153542903 18:6175207-6175229 CAGAGCCACGATGGGAAAGTGGG + Intronic
1156212315 18:34958184-34958206 CAAAGTAAACACTGGGAAGTGGG - Intergenic
1157884597 18:51354374-51354396 CAGAGCCACCAGGGTGGAGTCGG - Intergenic
1160155250 18:76429027-76429049 CAGGCTGACCCCGGGGAAGTTGG + Intronic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161226870 19:3150889-3150911 CAGAGTCACCCCCGGGAACAGGG - Intronic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1162327689 19:10008500-10008522 CAGGGCCCCCACGGGGATGTTGG + Intronic
1162520084 19:11174486-11174508 CTGCTGCACCACGGGGAAGTTGG + Exonic
1162664037 19:12194949-12194971 CAGAGGCGCCACGTGGAAGGTGG + Intergenic
1165259917 19:34604314-34604336 CATAGTGACCACAGGGATGTGGG - Intronic
1166976924 19:46610240-46610262 CCAAGTCACCACGGAGAAGCGGG - Exonic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927484226 2:23477859-23477881 CAGAGACACCCCAGGGCAGTGGG + Intronic
928106218 2:28472068-28472090 CAGAGGCACCAAGTGCAAGTGGG - Intronic
929317233 2:40494163-40494185 GGGAGTCACCACATGGAAGTGGG - Intronic
930075255 2:47401151-47401173 CAGAATCACCCTGGGGAGGTGGG - Intergenic
933100603 2:78251900-78251922 CAGAGACAAAAAGGGGAAGTGGG - Intergenic
935401491 2:102665040-102665062 CAGAGTGACAATGGGGAAATGGG + Intronic
939646318 2:144703603-144703625 CAAAGTCACTACTTGGAAGTGGG + Intergenic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
946366519 2:219252453-219252475 CAGATTCCCCACTGAGAAGTGGG - Intronic
1174399974 20:50270699-50270721 CGGAATCCCCAAGGGGAAGTTGG - Intergenic
1178597928 21:33971860-33971882 CAGAGCCTCCACGGGGATCTTGG - Intergenic
1179030989 21:37719183-37719205 CAGAGTCATCACAGGGAATGGGG + Intronic
1179187657 21:39097113-39097135 CAGGGCCTCCACGGGGAAGGTGG - Intergenic
1180611663 22:17102154-17102176 CAGGGTCTCCACGGTGATGTTGG - Exonic
1181563367 22:23718398-23718420 TGGATTCACCACTGGGAAGTTGG - Intergenic
1184319899 22:43733280-43733302 CAGCGTCACCACCTGGAACTGGG + Intronic
949738776 3:7205689-7205711 GTGATTCACCACGGGGAAGCAGG + Intronic
950964623 3:17137720-17137742 CTGAGTCACCATGGGGCAGGAGG - Intergenic
960742484 3:120850560-120850582 CAGAGGCACCATGGGGGGGTTGG - Intergenic
960811518 3:121631680-121631702 CAGAGACAGCATGGGGAAGGAGG - Exonic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961640163 3:128360158-128360180 CAGAGCCACTATGGAGAAGTGGG - Intronic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
963972310 3:151443562-151443584 CAGAATCATCCCAGGGAAGTAGG - Exonic
967294255 3:187949758-187949780 CAGAGTCACAACCTGGAATTGGG - Intergenic
969449758 4:7266266-7266288 CAGAGTCCCTCCGTGGAAGTTGG + Intronic
969921514 4:10544803-10544825 CAGAGTCACCACCCGCAAGAAGG - Intronic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
976187831 4:82459894-82459916 CAAAGTCAGCAGGGGGATGTGGG - Intronic
977648542 4:99442369-99442391 CATATTCACCACGGAAAAGTAGG + Intergenic
979342404 4:119541845-119541867 CAGAGTCACCTGGGGGAGCTTGG + Intronic
982056856 4:151559421-151559443 CTGAGTCAGCACAGGGCAGTGGG - Intronic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
984926749 4:184813960-184813982 CATAGTCACCACGGGAAGATGGG - Intronic
985652079 5:1111962-1111984 CACGGGCACCACGGTGAAGTTGG + Exonic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
997690729 5:135825907-135825929 CAGTCACACCACGGGGAAGCCGG + Intergenic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1001415160 5:171540511-171540533 CAGAGGCAGCACAGGGGAGTCGG - Intergenic
1001447246 5:171794999-171795021 CAGAGTCCCCACAGGTGAGTGGG + Intergenic
1001641438 5:173246711-173246733 CAGAGTGATCCCGGGCAAGTCGG - Intergenic
1004346135 6:14850852-14850874 CAGCGACACCAAGGGAAAGTGGG - Intergenic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1009240403 6:61179469-61179491 CAGAGTCACCTGGTGGAAGCTGG + Intergenic
1010190998 6:73196385-73196407 CAGAAACACCACCAGGAAGTTGG + Exonic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011182778 6:84639911-84639933 CAGAGACAACACCTGGAAGTGGG - Intergenic
1017433084 6:154390596-154390618 CAGAGACACAACGGGGCACTAGG - Exonic
1019089940 6:169520068-169520090 CAGAGACAAAAGGGGGAAGTGGG + Intronic
1022308594 7:29174066-29174088 CATAGTCTCCATGGGGAAGAGGG + Intronic
1022683552 7:32573112-32573134 CAGAGTAACTACGGGGAAGGTGG - Intronic
1024674598 7:51626827-51626849 ATGACTCACCACGGGGAAGCTGG - Intergenic
1025095428 7:56092251-56092273 CAGGGTCACCACATGGGAGTAGG + Intronic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1030816849 7:114049394-114049416 CAGATTCACCACTGGTAACTTGG + Intronic
1032087404 7:128891290-128891312 CAGACGCACCACGGGTCAGTGGG + Intronic
1033267073 7:139895721-139895743 CAGAATCACCAGGTTGAAGTGGG + Intronic
1036445807 8:8821033-8821055 GTGAGTCAGCACAGGGAAGTGGG + Intronic
1040432338 8:47355880-47355902 AAGAGCCACCACGGGGAAGTGGG - Intronic
1043891146 8:85654193-85654215 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043892222 8:85661030-85661052 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043893341 8:85716310-85716332 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896024 8:85737759-85737781 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896655 8:85744049-85744071 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043898978 8:85762416-85762438 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043900589 8:85774610-85774632 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043902553 8:85789885-85789907 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043904163 8:85802078-85802100 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043905775 8:85814272-85814294 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043907383 8:85826459-85826481 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1045128925 8:99126250-99126272 CAGAGTAAGCATGGGGAAGGAGG + Intronic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1050313134 9:4373323-4373345 CAGAATCACCTGGGGGAAATTGG + Intergenic
1051088219 9:13376896-13376918 AAGAGTCCCCATGGGGTAGTGGG + Intergenic
1057969669 9:99542313-99542335 CAGAGGTACCACTGGGAACTTGG + Intergenic
1059021235 9:110579190-110579212 CGTGGGCACCACGGGGAAGTCGG + Exonic
1060259870 9:122065016-122065038 GAGTGTCACCACTGGGAATTTGG - Intronic
1062107440 9:134763690-134763712 CAGGGTGACGACGGAGAAGTTGG + Exonic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1185571802 X:1140347-1140369 CAGACACACCATGGGTAAGTAGG + Intergenic
1186594053 X:10961328-10961350 AAGATTCACCCTGGGGAAGTAGG + Intergenic
1186874448 X:13803311-13803333 CTGAGTCGCCACGGGGTTGTGGG - Intronic
1190332248 X:49243077-49243099 CAGAATCTCCAGGGTGAAGTGGG - Intronic
1192268472 X:69556468-69556490 CAGAGAAACCCAGGGGAAGTGGG + Intergenic
1193005490 X:76614175-76614197 CTGATCCACCACGGTGAAGTCGG + Intergenic
1198641623 X:138762251-138762273 CAAAGGCACCATTGGGAAGTTGG - Intronic