ID: 1152066374

View in Genome Browser
Species Human (GRCh38)
Location 17:78114863-78114885
Sequence CACCACAGCCAGCATCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152066368_1152066374 11 Left 1152066368 17:78114829-78114851 CCCAAAGACGGGTCAGAGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 250
1152066370_1152066374 10 Left 1152066370 17:78114830-78114852 CCAAAGACGGGTCAGAGCTCGGC 0: 1
1: 0
2: 3
3: 6
4: 50
Right 1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 250
1152066367_1152066374 12 Left 1152066367 17:78114828-78114850 CCCCAAAGACGGGTCAGAGCTCG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 250
1152066366_1152066374 19 Left 1152066366 17:78114821-78114843 CCGACAGCCCCAAAGACGGGTCA 0: 1
1: 0
2: 1
3: 15
4: 85
Right 1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152066374 Original CRISPR CACCACAGCCAGCATCCGCC TGG Intronic
900338758 1:2177811-2177833 CAACACAGCCCGCAGCAGCCAGG - Intronic
900410204 1:2509181-2509203 CTCCAAACCCAGCCTCCGCCTGG + Intronic
900571975 1:3363103-3363125 CATCACAGCCAGCCTCCCCTGGG + Intronic
901631652 1:10651038-10651060 CACCCCAGCCAGGTTCCCCCCGG - Exonic
902512655 1:16974772-16974794 CACCGCAGCCTGCAACCCCCAGG + Exonic
903791279 1:25894858-25894880 CACCACACCCAGCAACAGGCTGG + Intronic
904714277 1:32455270-32455292 CACCACAGCCTCCACCTGCCTGG - Intergenic
904803924 1:33117946-33117968 AATCACAGCCATCAACCGCCGGG - Exonic
904870958 1:33617857-33617879 CAGGACAGCCAGCATCCCCTGGG - Intronic
905269605 1:36778911-36778933 CGCCACTGCCTGGATCCGCCAGG + Intergenic
905607077 1:39311015-39311037 CTCCACAACCAGCATCCACATGG - Intronic
905734553 1:40316610-40316632 AACCACACCCAGCACCCGACCGG + Intronic
906384142 1:45352972-45352994 CACCACAGCCACCATCTCCTGGG + Intronic
906992700 1:50755678-50755700 CCCCACAGCAAGCTTCTGCCTGG + Intronic
908962174 1:69711161-69711183 CACCACAGCCATCCTCAGCAAGG - Intronic
914921510 1:151850708-151850730 TCCCACAGCCAGCAGCAGCCAGG + Intronic
917130542 1:171738042-171738064 CACCACAGCCTTCATCTCCCAGG + Intronic
918445414 1:184612435-184612457 CACCACACCCGGCCTCAGCCAGG - Intronic
921110853 1:212035389-212035411 CGCCATAGCCGGCATCTGCCAGG + Exonic
921159412 1:212462721-212462743 CACCCCAGCAAGCCTCCCCCAGG + Intergenic
921727482 1:218539717-218539739 CACCACAGACAGCCTTCACCAGG + Intergenic
923685011 1:236147714-236147736 CAGCTCAGCAAGCATCTGCCCGG + Intronic
924744325 1:246818306-246818328 CACCGCAGCCTGCAACCCCCAGG - Intergenic
1063114863 10:3066690-3066712 CACCACAGCCCCCATGGGCCCGG + Intronic
1063444960 10:6107250-6107272 CACCACAACCTGCAACCTCCTGG + Intronic
1064647363 10:17473163-17473185 CACCACAATCAGCAACAGCCTGG - Intergenic
1067046774 10:42989607-42989629 CCCCACAGCCTCCATCCCCCTGG - Intergenic
1068171255 10:53397362-53397384 CACCACAACCACCATCTCCCGGG - Intergenic
1070782955 10:79148038-79148060 CACCACAGCCCTCCTCCTCCAGG - Intronic
1071937194 10:90545301-90545323 CACCACACCCAGCCTCCTGCAGG - Intergenic
1072260842 10:93670580-93670602 CAACACATCCAGCTTCCTCCTGG - Intronic
1072290089 10:93956845-93956867 CACCACAGCCTCCATCTGCCAGG + Intergenic
1073521442 10:104134107-104134129 CACCACACCCAGCATCAGGTGGG - Intronic
1073553770 10:104428199-104428221 CATCACTGTCAGCATCCGCCAGG + Intronic
1074445027 10:113514517-113514539 CACCACACCCAGCCTCCATCTGG + Intergenic
1076055301 10:127367829-127367851 CCCCACAGGCAGCAGCCTCCTGG - Intronic
1076738082 10:132467627-132467649 CCCCAAAGCCAGCCTCTGCCCGG + Intergenic
1076787127 10:132756096-132756118 CAACACACTCAGAATCCGCCTGG + Intronic
1076806565 10:132862032-132862054 CGCCACAGCCTGCATGCACCTGG + Intronic
1077499974 11:2904912-2904934 CTCCACAGCCATCACCAGCCCGG - Intronic
1077505468 11:2928115-2928137 CACCACAGGCAGCAGCAGCTCGG + Intergenic
1077618496 11:3697121-3697143 CACCACATCCAGCCTCCGTCTGG - Intronic
1078004688 11:7523734-7523756 CACCACAGCGACCATAAGCCTGG - Intronic
1078287452 11:9971601-9971623 CACCACAGCCTCCATCTCCCAGG - Intronic
1079071834 11:17353617-17353639 CACCACCACCAGCATCCGCGGGG - Intronic
1082028041 11:47586964-47586986 CACCACAGCACACATCAGCCTGG - Intronic
1083148687 11:60776487-60776509 CACCACAGTCAGCATCGACAGGG + Exonic
1083285995 11:61659484-61659506 CACCAGCGCCAGAATCCCCCAGG + Intergenic
1084203823 11:67579405-67579427 CAACACAGCCTGCAGCCTCCAGG - Intergenic
1084400158 11:68938812-68938834 CACCAGGCCCAGCATCCTCCAGG - Intronic
1084465782 11:69322245-69322267 CATCACAACCACCATCTGCCAGG - Intronic
1084495764 11:69502132-69502154 CACCAGAGGCAGCATGCCCCAGG - Intergenic
1084887521 11:72220896-72220918 CTGCACAGCCAGCACCAGCCAGG + Exonic
1085006070 11:73091749-73091771 CACCACGCCCAGCATCAGCTAGG - Intronic
1085745708 11:79112568-79112590 CACCACAGCCAGCCTGACCCTGG - Intronic
1088044035 11:105425717-105425739 CACCACACCCAGCCTCTGACTGG - Intergenic
1089543738 11:119206541-119206563 CACCTCAGCCCCCACCCGCCGGG + Exonic
1090211435 11:124923542-124923564 CTCCACCACCAGCATCAGCCAGG - Intronic
1090398906 11:126435980-126436002 CACCACAGCCAGCAGCAAGCCGG - Intronic
1092238856 12:6825524-6825546 CAGCACAGCCAGCACCATCCAGG - Exonic
1093415641 12:18917348-18917370 CACCACATCCAGCGTTTGCCTGG + Intergenic
1094378730 12:29819189-29819211 CACCACTGCCAGCAGAGGCCTGG - Intergenic
1094503798 12:31043147-31043169 CACAACACCCAGCATCCAGCCGG - Intergenic
1095554351 12:43482954-43482976 CACCACTGCCTGCATCAGCCTGG + Intronic
1096780043 12:53986310-53986332 AACCACAGCCAGCACGCGCCTGG - Intronic
1097243864 12:57594892-57594914 CACCACAACCTCCATCCCCCGGG - Intronic
1097886354 12:64732998-64733020 CACCACAGCCAGTCTACCCCAGG - Intronic
1098080979 12:66785434-66785456 CACCACAGCTTCCATCCCCCAGG - Intronic
1101781877 12:107844699-107844721 CGGCACAGCCAGCATCGGCACGG - Intergenic
1102426858 12:112850557-112850579 AACCACAGCCAGAATCTTCCGGG - Intronic
1103478608 12:121236404-121236426 CACCACACCCAGCCTCCTGCTGG - Intergenic
1103914974 12:124371565-124371587 CACGACCGCCAGCAGCGGCCAGG + Intronic
1104459673 12:128945174-128945196 CACCACACGCAGCAGCCGCGAGG + Intronic
1105013043 12:132768436-132768458 CACCACACCCAGCTTACGCCTGG + Intergenic
1105014683 12:132779019-132779041 CCCCACAGGCCTCATCCGCCCGG - Intronic
1107639921 13:42431547-42431569 CAGCACCGCCAGCATCCCCTAGG - Intergenic
1108022055 13:46137462-46137484 CACCACAACCTCCACCCGCCAGG - Intronic
1113866812 13:113531898-113531920 CTCCACAGCCACCATCCCCAGGG - Intronic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1122820255 14:104340062-104340084 CACCACAGCCTCAATCCCCCAGG - Intergenic
1123833877 15:24168554-24168576 CACCACAGCCAGAACGCACCTGG - Intergenic
1123840617 15:24243602-24243624 CACCACAGCCAGAATGCACCTGG - Intergenic
1123849667 15:24342127-24342149 CACCACAGCCAGAACGCACCTGG - Intergenic
1123869538 15:24556724-24556746 CACCACAGCCAGAACGCACCTGG - Intergenic
1124215744 15:27806111-27806133 CCCAACAGCCAGCATGCGGCTGG - Intronic
1124252458 15:28115867-28115889 CACCACAGCCAGCACCTCCTGGG - Intronic
1127064557 15:55223216-55223238 CACCACACCCAGCCTCAGCAAGG - Intronic
1127552642 15:60056266-60056288 CACCACAACCTCCACCCGCCCGG + Intronic
1127672796 15:61211939-61211961 AACCAAGGTCAGCATCCGCCTGG + Intronic
1127760805 15:62137483-62137505 CTCCACTGCCAGCATTTGCCTGG - Intergenic
1128127605 15:65204535-65204557 CATCACAGTCAGCATTCACCTGG + Exonic
1128860987 15:71071837-71071859 CCCCACCTCCAGCATCCTCCTGG + Intergenic
1129016652 15:72474600-72474622 CGCCTCGGCCAGCGTCCGCCGGG + Exonic
1129435955 15:75540664-75540686 CACCTCACCTAGCAGCCGCCTGG - Intronic
1132654270 16:1035336-1035358 CACCCCAGGCAGCGTCCGCTTGG - Intergenic
1133056848 16:3149667-3149689 GACCACACCCAGCCTGCGCCCGG - Intronic
1133970710 16:10566025-10566047 CACCACCCCCAGCCTCTGCCTGG + Intronic
1134115311 16:11543645-11543667 CACCGCATCCAGCCTCCCCCAGG + Intergenic
1136139767 16:28281300-28281322 CACCCCAGCCTGCCTCCTCCGGG + Intergenic
1136288916 16:29260056-29260078 CACCCCAGCCAGCCTGCACCCGG - Intergenic
1137495662 16:48967180-48967202 CTCCACAGCCAGCCTGTGCCAGG - Intergenic
1139505751 16:67397393-67397415 ACCCACAGCCAGCATGCCCCAGG + Intronic
1140937965 16:79692513-79692535 CAGCAAAGCCAGCATGCACCAGG - Intergenic
1141646579 16:85370989-85371011 GGCCACAGCCAGCCACCGCCGGG - Intergenic
1141962360 16:87417671-87417693 CACCACGGGCAGCACCCGGCCGG - Exonic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142094644 16:88232963-88232985 CACCCCAGCCAGCCTGCACCCGG - Intergenic
1142288335 16:89180656-89180678 AACCACAGCCAGCAACCCACTGG + Intronic
1142349780 16:89574822-89574844 CAGCACAGGCAGCCTCGGCCTGG - Intergenic
1142541173 17:660653-660675 CACCACACCCAGCAGCACCCAGG - Intronic
1142541186 17:660700-660722 CACCACACCCAGCAGCACCCAGG - Intronic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1143084644 17:4406570-4406592 CACCACACCCAGCCCGCGCCGGG + Intergenic
1143446983 17:7015437-7015459 CAACACAGCCTGCAGCCGTCTGG - Intronic
1144563419 17:16340578-16340600 CACCACATGCAGCTTCAGCCTGG + Intronic
1145359692 17:22202032-22202054 CACCACATGCAGCTTCAGCCTGG + Intergenic
1145740497 17:27270234-27270256 CACCACACCCGGCGTCCTCCAGG - Intergenic
1148157992 17:45434224-45434246 CACCACTGCCAGCCACTGCCTGG - Intronic
1148344519 17:46894587-46894609 CACCACAGCCACATTCCACCAGG - Intergenic
1150389593 17:64782493-64782515 CACCACTGCCAGCCGCTGCCTGG - Intergenic
1151340737 17:73469299-73469321 CATCACTGCCAGCATCACCCAGG + Intronic
1152066374 17:78114863-78114885 CACCACAGCCAGCATCCGCCTGG + Intronic
1152699401 17:81811647-81811669 CACGGCAGCCAGCCACCGCCTGG - Exonic
1152919102 17:83056933-83056955 ATCCACAGCGAGCATCTGCCCGG - Intergenic
1152923408 17:83077058-83077080 CACCTCAGCCTGCATCCTCTAGG + Intergenic
1153249460 18:3106745-3106767 CACCACAGCCTCCATCTCCCAGG - Intronic
1155571199 18:27195858-27195880 GAACACAACCAGCATCCACCGGG - Intergenic
1157260099 18:46169997-46170019 CACCATAGCCAGCACCCACTAGG - Intergenic
1157628245 18:49069963-49069985 CACCACAACCTGCACCCCCCGGG - Intronic
1159383790 18:67696272-67696294 CACCACAGCCTCCATCTCCCGGG + Intergenic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1160220765 18:76975940-76975962 CACTACCGCCAGCACCAGCCAGG - Intergenic
1160281972 18:77499353-77499375 CACCAGAGCCAGGAACCACCAGG - Intergenic
1160354759 18:78217505-78217527 CACCACTGCCAGCATGTGCAGGG + Intergenic
1160776568 19:859362-859384 CACCACACCCAGAGTCCCCCAGG - Intergenic
1161077037 19:2290850-2290872 CACCACAGCCAGCAGGGCCCCGG + Exonic
1161099389 19:2413852-2413874 CACCAAAGCCAGCATGCCTCTGG + Exonic
1161289152 19:3483491-3483513 CCCCACGGCCACCATCTGCCTGG + Intergenic
1161478741 19:4500144-4500166 CCCCACAGCCAGCAGCCCCGAGG - Intronic
1161574698 19:5049008-5049030 CACGACAGCCAGCAACCCCCGGG - Intronic
1161984359 19:7645536-7645558 CACCACTGCCAGGACCAGCCTGG - Intronic
1161989442 19:7676452-7676474 CACCGCACCCAGCCTCCTCCAGG + Intergenic
1162016606 19:7849728-7849750 GGCCACTGCCAGCATCCCCCTGG - Intronic
1163519540 19:17783867-17783889 CACCACACCCAGCCACCTCCTGG + Intronic
1163631815 19:18421410-18421432 CTCCAGAGCCAGCAGCTGCCTGG - Intronic
1163641484 19:18464939-18464961 CACCACAGCCGGCAACAGGCAGG - Intronic
1164708110 19:30335377-30335399 CACCACAGCCACCCCCAGCCTGG + Intronic
1166558796 19:43718702-43718724 CTCCACGGAAAGCATCCGCCTGG + Exonic
1167553126 19:50174793-50174815 CACCACAGCCGGCCCCAGCCAGG - Intergenic
1167571407 19:50291148-50291170 ACCCACAGGCAGCATCCGCATGG + Intronic
1167716810 19:51147335-51147357 CTCCACACCCAGCATCCAGCTGG + Intronic
1167971473 19:53190208-53190230 GCCCACAGCCAGCAACAGCCCGG + Intronic
1168001122 19:53446908-53446930 CACCAGACCCAGCATCTGCATGG + Intronic
1168173919 19:54609123-54609145 CACCATTGCCAGCAACCCCCTGG + Intronic
925031365 2:652255-652277 CACCACAGCCCACACCCGCTGGG + Intergenic
925169971 2:1744372-1744394 CACCACGGCCAGCGTCCCCCAGG + Exonic
927190775 2:20515552-20515574 CACAGCAGCCAGAATCCCCCCGG + Intergenic
927638246 2:24831452-24831474 CACCACAGCCTGCCACAGCCTGG + Intronic
928374158 2:30761480-30761502 CTCCACAGCCAGCCTCTGCGGGG + Intronic
929755018 2:44757189-44757211 CAGCCAAGCCAGCATCCCCCTGG - Intronic
931217455 2:60259995-60260017 CACATCAGCCAGCTTCCTCCTGG + Intergenic
931309352 2:61064109-61064131 CACCACACCCAGCCCCAGCCAGG - Intergenic
931695240 2:64865920-64865942 AACCACAGAAAGCATCCCCCAGG - Intergenic
931934013 2:67175682-67175704 CACTACAGCCAGCAGCCCCTAGG + Intergenic
933247851 2:79995697-79995719 CACCTCAGCCACCAACTGCCTGG - Intronic
934473829 2:94579389-94579411 CAACACAGCCAGGACCGGCCAGG + Intergenic
935134126 2:100284445-100284467 CAGCACGGCCAGGATCCACCAGG + Exonic
935753148 2:106256563-106256585 CACCACAGCCTCCATCTCCCAGG - Intergenic
938069240 2:128299821-128299843 CAGCACCCCCAGCCTCCGCCTGG - Intronic
943978001 2:194508514-194508536 CACCACAGGCAGCCTGGGCCAGG - Intergenic
944615013 2:201451449-201451471 TCCCACTGCCAGCAACCGCCCGG + Exonic
944724060 2:202451823-202451845 CACCACAACCACCATCTCCCAGG + Intronic
945273130 2:207961807-207961829 CAACACTGACAGCATCCACCTGG - Intronic
947850998 2:233288065-233288087 CAGCACAGCCGGCACCCGACTGG + Intronic
948192401 2:236070055-236070077 CGCCACAGCCAGCAGATGCCAGG - Intronic
948502886 2:238407849-238407871 AACCAGAGCCAGGGTCCGCCTGG - Intergenic
1170118684 20:12888728-12888750 CACCACAACCACCATCTCCCAGG - Intergenic
1170898627 20:20438586-20438608 GACCACAGGCAGCATGGGCCCGG + Intronic
1171294666 20:24006832-24006854 CCCCACAGCCAGCACACCCCAGG - Intergenic
1171725841 20:28620401-28620423 CACCAAAGCCAGCCCCCGGCAGG + Intergenic
1174036117 20:47669295-47669317 CGCCACAGCCAGGATCCCCGTGG + Intronic
1176052830 20:63129719-63129741 GAGCACAGCCACCATCCCCCGGG + Intergenic
1176075024 20:63244484-63244506 CACTCCAGCCAGCAGCCACCAGG + Intronic
1177307774 21:19342540-19342562 CACCACACCCAGCCTCCGTCTGG + Intergenic
1178488602 21:33033824-33033846 CGGCACGGCCCGCATCCGCCAGG + Intergenic
1179165475 21:38932192-38932214 CACCACAGCCTGGACCTGCCAGG + Intergenic
1180390744 22:12280007-12280029 CACCAAAGCCAGCCCCCGGCAGG + Intergenic
1180408998 22:12584750-12584772 CACCAAAGCCAGCCCCCGGCAGG - Intergenic
1180674840 22:17580005-17580027 CACCACAGCGACTCTCCGCCAGG - Intronic
1181754119 22:25010963-25010985 CACCACAAGCTGCATCTGCCTGG + Intronic
1182676346 22:32042626-32042648 CTCCACAGCCTGCAGCCCCCAGG - Intergenic
1183620055 22:38966990-38967012 CACCTCAGCGAGCACCGGCCAGG + Intronic
949967766 3:9373202-9373224 CACCACACCCAGCCTCCTCTGGG - Intronic
950523363 3:13509244-13509266 CACCACAGCCACCCCCCGCAAGG - Intergenic
950893612 3:16427752-16427774 CACCACACACAGCCTCCTCCAGG + Intronic
952930129 3:38353597-38353619 CACCACACCCAGCCTCAACCGGG + Intronic
958915987 3:100050816-100050838 CACCGCACCCAGCCTCCCCCAGG + Intronic
964730479 3:159859535-159859557 CACCATTAGCAGCATCCGCCAGG - Intronic
965685856 3:171301601-171301623 CACCACATCCAGCCTTAGCCTGG + Intronic
968517916 4:1022628-1022650 CACCTCTGCCACCATCCCCCAGG + Intronic
968844750 4:3034453-3034475 CACCACAGGCACCAGCTGCCTGG - Intronic
969554466 4:7896858-7896880 CACCCCAGCCCCCAACCGCCCGG + Intronic
981928601 4:150166416-150166438 CACCACAGCCTTCATCTCCCAGG - Intronic
984648683 4:182246231-182246253 CACCACTGCCAGCAGCCCCAAGG + Intronic
985204806 4:187523736-187523758 CACCACAACCACCATCTCCCAGG - Intergenic
985434715 4:189917394-189917416 CACCAAAGCCAGCCCCCGGCAGG - Intergenic
986376390 5:7136392-7136414 CCACACAGCCACCATCCACCAGG + Intergenic
986399962 5:7370908-7370930 CACCACAGCCTCCATCTCCCGGG - Intergenic
986539477 5:8828711-8828733 CACCACTGCCTGCATCATCCTGG + Intergenic
989186537 5:38631744-38631766 CTCCACAGCCTGGATCGGCCAGG + Intergenic
989393277 5:40924609-40924631 CCCTACAGCCAGCTTCTGCCTGG + Intronic
993352268 5:86865344-86865366 CAACACAGCCTGCATCCCTCGGG + Intergenic
997430680 5:133838445-133838467 CAGCTCAGCCAGCATCTGACTGG - Intergenic
999251826 5:150187121-150187143 GAGCACAGCCAGCCTCCGCCAGG + Intergenic
999282787 5:150375953-150375975 CACCACAGTCAGCACCCCCGGGG + Intronic
999738137 5:154528088-154528110 CAGCATAGCCATCATCCCCCAGG + Intergenic
1002704214 5:181149200-181149222 CACCCCTGCCAGCCCCCGCCTGG - Intergenic
1005810434 6:29511139-29511161 CACCACAGCCTACCTCAGCCAGG + Intergenic
1005847995 6:29797353-29797375 CACAACAGCCAGCTTCCCCCAGG - Intergenic
1006610483 6:35291604-35291626 CACCACATCTAACATCCGCAAGG + Exonic
1009631944 6:66211020-66211042 CACCACAGCCTGCACCTGTCGGG - Intergenic
1010261687 6:73824340-73824362 CAGCACACCCAGCACCCCCCAGG - Exonic
1013605290 6:111741885-111741907 CAGCACAGCCAGCATAACCCTGG - Intronic
1017123142 6:151042995-151043017 CAACACAGCCAGGACCGGCCAGG - Intronic
1017594970 6:156018455-156018477 CACCCAAGCCAGCAGCCACCAGG - Intergenic
1017617091 6:156257253-156257275 CACCACGGCCAGCACACACCTGG + Intergenic
1019524516 7:1474725-1474747 CGCCACCGCCAGCTTCCGGCAGG + Exonic
1019713029 7:2525993-2526015 CACCCCAGGCACCATCCGGCAGG + Intronic
1021459697 7:20872256-20872278 CACCACAGCCTCCATCTCCCAGG - Intergenic
1021511059 7:21432916-21432938 CACCGCAGCCTGGATCCCCCGGG - Intronic
1024522347 7:50316523-50316545 CACCACAGCGAGCACCTTCCTGG - Intronic
1028033492 7:85949546-85949568 CACCACAGCCAGGATGCCCTGGG + Intergenic
1030078796 7:105759510-105759532 CACCACTCCCAGCATCCACCTGG - Intronic
1031273614 7:119688397-119688419 CAGCAAAGACAGCATCCTCCTGG - Intergenic
1033218879 7:139514549-139514571 CACCGCACCCAGCCTCCACCTGG + Intergenic
1033660427 7:143398610-143398632 CACCTCAGTCAGCATCAGCATGG - Exonic
1034413337 7:150952617-150952639 CACCACAGCCAGCGGCTGGCAGG + Exonic
1036972706 8:13372912-13372934 CACCATGCCCAGCATCCACCAGG + Intronic
1037497570 8:19454593-19454615 CACCACAGCCTCCATCTCCCAGG - Intronic
1039070206 8:33642870-33642892 CACTACAGACAGCACCTGCCAGG - Intergenic
1040435147 8:47383011-47383033 CACCACAGACAGCCTCCCACAGG - Intronic
1042372395 8:68006485-68006507 CACCTCAAGCAGCATCCGTCAGG + Intronic
1048879083 8:138858533-138858555 CACCACATCCAGCTTTCCCCTGG + Intronic
1049534223 8:143170644-143170666 CACAGCAGCCAGCACCCCCCAGG - Intergenic
1049782699 8:144436065-144436087 AGCCACAGCCAGCACCAGCCGGG - Exonic
1049845549 8:144799121-144799143 GACCACAGCCAGCATGGACCGGG - Intronic
1053684500 9:40509120-40509142 CAACACAGCCAGGACCGGCCAGG - Intergenic
1053934470 9:43137407-43137429 CAACACAGCCAGGACCGGCCAGG - Intergenic
1054279225 9:63115832-63115854 CAACACAGCCAGGACCGGCCAGG + Intergenic
1054297597 9:63344587-63344609 CAACACAGCCAGGACCGGCCAGG - Intergenic
1054395611 9:64649093-64649115 CAACACAGCCAGGACCGGCCAGG - Intergenic
1054430256 9:65154293-65154315 CAACACAGCCAGGACCGGCCAGG - Intergenic
1054500125 9:65867239-65867261 CAACACAGCCAGGACCGGCCAGG + Intergenic
1055396783 9:75884099-75884121 CACCACAACCACCATCTCCCGGG - Intergenic
1056676640 9:88681873-88681895 CACCACAGCCAGCAGGCACTGGG - Intergenic
1056723307 9:89089834-89089856 CACCACAGCCAGCACCTTCTTGG + Intronic
1060180317 9:121529199-121529221 CAGCCCAGACAGCATCTGCCTGG - Intergenic
1060853677 9:126898154-126898176 CACCACGCCCAGCCTCTGCCTGG - Intergenic
1061009719 9:127947895-127947917 CACCACAGCCAGCACGCACAAGG + Intronic
1203451391 Un_GL000219v1:120531-120553 CACCAAAGCCAGCCCCCGGCAGG + Intergenic
1187648209 X:21373664-21373686 CACCACAACCAGCAGCTGGCAGG + Intergenic
1192363165 X:70451993-70452015 CTCCTCAGCCAGCATGTGCCTGG - Exonic
1192774259 X:74225537-74225559 CACCACAGCCATCATCTCCCGGG + Intergenic
1196037945 X:111167474-111167496 CACCACAATCAGCATCTGCATGG - Intronic
1197603776 X:128560928-128560950 CACCACAGCCTGCAACACCCTGG + Intergenic
1200055317 X:153457027-153457049 CACCCCAGCCAGCATCAGAGGGG + Intronic
1200156125 X:153976453-153976475 CACCACAGCCTGCGTCTCCCAGG - Intronic