ID: 1152068147

View in Genome Browser
Species Human (GRCh38)
Location 17:78122593-78122615
Sequence GGGGCCACTCACCTTCAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1654
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 1587}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152068137_1152068147 17 Left 1152068137 17:78122553-78122575 CCAGGCCTGCAGGGAGCTGGGCA 0: 1
1: 1
2: 8
3: 77
4: 584
Right 1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG 0: 1
1: 0
2: 3
3: 63
4: 1587
1152068139_1152068147 12 Left 1152068139 17:78122558-78122580 CCTGCAGGGAGCTGGGCAGGCCA 0: 1
1: 0
2: 9
3: 54
4: 538
Right 1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG 0: 1
1: 0
2: 3
3: 63
4: 1587
1152068144_1152068147 -8 Left 1152068144 17:78122578-78122600 CCAGCTTGGTGCTCCGGGGCCAC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG 0: 1
1: 0
2: 3
3: 63
4: 1587
1152068134_1152068147 23 Left 1152068134 17:78122547-78122569 CCAGGGCCAGGCCTGCAGGGAGC 0: 1
1: 0
2: 13
3: 86
4: 756
Right 1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG 0: 1
1: 0
2: 3
3: 63
4: 1587
1152068133_1152068147 24 Left 1152068133 17:78122546-78122568 CCCAGGGCCAGGCCTGCAGGGAG 0: 1
1: 0
2: 9
3: 87
4: 671
Right 1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG 0: 1
1: 0
2: 3
3: 63
4: 1587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152068147 Original CRISPR GGGGCCACTCACCTTCAGCC GGG Exonic
900139578 1:1134038-1134060 GGGGCCACTGCACTCCAGCCTGG + Intergenic
900185244 1:1330382-1330404 GGGGGCACTCAGCTTCAGCTAGG - Intergenic
900236274 1:1592799-1592821 GGCGCCACTGAACTCCAGCCTGG + Intergenic
900284933 1:1894526-1894548 GGTGCTTCTCACCTCCAGCCAGG + Intergenic
900372602 1:2338811-2338833 GGTGCCAGGCACCTTCAGGCAGG + Intronic
900547456 1:3236678-3236700 GGGTCCACTCACCTTGATCTTGG + Intronic
900660107 1:3777928-3777950 GGGGCCCAGCATCTTCAGCCAGG + Intergenic
901103444 1:6737154-6737176 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
901163125 1:7195594-7195616 TGGCACACTCACCTTCAGCCAGG + Intronic
901284038 1:8062308-8062330 GGCGCCACTGTACTTCAGCCTGG - Intergenic
901298009 1:8175583-8175605 GGGGCCACTGCACTTCAGCCTGG + Intergenic
901582295 1:10254831-10254853 CGTGCCACTCCCCTTCAGCTAGG + Intronic
901683421 1:10929577-10929599 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
901698948 1:11032863-11032885 GGCGCCACTCCACTCCAGCCTGG + Intronic
901717879 1:11171324-11171346 TGTGCCACTGAACTTCAGCCTGG - Intronic
901735910 1:11312084-11312106 GAGGCCACACTCCCTCAGCCTGG + Intergenic
902325194 1:15695553-15695575 GGCGCCACTGTCCTCCAGCCTGG - Intronic
902352700 1:15869639-15869661 CATGCCACTCACCTCCAGCCTGG - Intronic
902532711 1:17100703-17100725 GGTGCCACTGCCCTCCAGCCTGG - Intronic
902837476 1:19056408-19056430 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
902909732 1:19586582-19586604 GGTGCCACTGCACTTCAGCCTGG + Intergenic
902958000 1:19939915-19939937 TGGGCCACTGAACTCCAGCCTGG - Intergenic
903454281 1:23476300-23476322 GGTGCCACTGAACTCCAGCCTGG + Intronic
903491790 1:23734551-23734573 CGTGCCACTGAACTTCAGCCAGG - Intergenic
903640714 1:24858118-24858140 GGGGCCACTGTACTCCAGCCTGG - Intergenic
903728245 1:25468890-25468912 GGCGCCACTGCACTTCAGCCTGG - Intronic
903932463 1:26870980-26871002 GGCGCCACTGAACTCCAGCCTGG - Intergenic
903971604 1:27122570-27122592 GGGTCCCCTGACCTTCAGCCTGG + Intronic
904146056 1:28392444-28392466 GGGGCCACTGAACTCCAGTCTGG - Intronic
904230614 1:29067450-29067472 CGCGCCACTGCCCTTCAGCCTGG + Intronic
904522803 1:31109009-31109031 TGCGCCACTCAACTCCAGCCTGG + Intergenic
904630533 1:31838598-31838620 TGTGCCACTGAACTTCAGCCTGG - Intergenic
904733056 1:32609283-32609305 GGTGCCACTGCACTTCAGCCTGG + Intronic
905048213 1:35025421-35025443 GGCGCCACTGCACTTCAGCCTGG + Intronic
905228658 1:36496936-36496958 GGCGCCACTACCCTCCAGCCTGG - Intergenic
905262856 1:36731544-36731566 GGGGCCTGTGACCTGCAGCCAGG - Intergenic
905321613 1:37121213-37121235 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
905487534 1:38313882-38313904 GGGGCCACTGCACTCCAGCCTGG + Intergenic
905600335 1:39244619-39244641 GGCGCCACTGCACTTCAGCCTGG - Intronic
905715910 1:40149701-40149723 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
906088637 1:43157839-43157861 GGGGCCACTGCACTCCAGCCTGG + Intergenic
906169283 1:43710123-43710145 GGGGCCACTGCACTCCAGCCTGG - Intronic
906358603 1:45131679-45131701 TGGGCCACTGAACTCCAGCCTGG + Intronic
906495081 1:46299831-46299853 GGCGCCACTGCACTTCAGCCTGG + Intronic
907164433 1:52398005-52398027 GGGGCCACTGCACTCCAGCCTGG - Intronic
907186126 1:52610572-52610594 CGAGCCACTCTTCTTCAGCCTGG - Intergenic
907431935 1:54417548-54417570 GGGGCCACTGCACTCCAGCCTGG - Intergenic
907622421 1:55995103-55995125 GGCGCCACTGAACTCCAGCCTGG + Intergenic
907874533 1:58472926-58472948 GTGGCCACTCACCATGTGCCAGG + Intronic
908274287 1:62453653-62453675 GGCGCCACTGCACTTCAGCCTGG - Intergenic
908361773 1:63375156-63375178 GGTGCCACTGCACTTCAGCCTGG + Intronic
908766926 1:67562624-67562646 GGTGCCACTGCCCTTCAGCCTGG + Intergenic
908848064 1:68345131-68345153 GGCGCCACTGAACTCCAGCCTGG - Intergenic
908880363 1:68724874-68724896 GGTGCCACTGAACTCCAGCCTGG + Intergenic
909830443 1:80182400-80182422 GGGGCCACTGTGCTCCAGCCTGG + Intergenic
910043833 1:82888069-82888091 GGTGCCACTGAACTCCAGCCTGG - Intergenic
910688312 1:89940511-89940533 GGGGCCACTGCACTCCAGCCTGG + Intergenic
911192398 1:94960881-94960903 GGCGCCACTGCACTTCAGCCTGG - Intergenic
911895514 1:103428709-103428731 GGGGCCACTGCACTCCAGCCTGG + Intergenic
911995086 1:104757060-104757082 GTGGCCACTGCACTTCAGCCTGG + Intergenic
912052916 1:105553259-105553281 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
912367598 1:109147871-109147893 GGTGCCACTGAACTCCAGCCTGG - Intronic
912854075 1:113151722-113151744 CGTGCCACTGACCTCCAGCCTGG + Intergenic
912878145 1:113383886-113383908 CGGGCCGCTCCACTTCAGCCTGG - Intergenic
913136956 1:115900183-115900205 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
913169672 1:116221012-116221034 GGTGCCACTGAACTCCAGCCTGG + Intergenic
913244753 1:116861816-116861838 GGGGCCACTGCACTCCAGCCTGG - Intergenic
913249185 1:116897730-116897752 GGGGCCACTGCACTCCAGCCTGG + Intergenic
913306020 1:117429940-117429962 GGCGCCCCTCACCTCCAGACGGG + Intronic
914215815 1:145626907-145626929 CGTGCCACTCCCCTCCAGCCTGG + Intronic
914467759 1:147947292-147947314 CGTGCCACTCCCCTCCAGCCTGG + Intronic
914893550 1:151649929-151649951 GGTGCCACTGAACTCCAGCCTGG - Intronic
915195416 1:154185327-154185349 GGTGCCACTCTACTCCAGCCCGG + Intronic
915286219 1:154854189-154854211 TGGGCCACTGAACTCCAGCCTGG + Intronic
915395433 1:155580030-155580052 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
915486506 1:156224941-156224963 GGCGCCACTGCCCTCCAGCCTGG - Intronic
916027517 1:160846620-160846642 GGTGCCACTCCCCTCCTGCCTGG + Intronic
916680142 1:167096212-167096234 CGCGCCACTGAACTTCAGCCTGG + Intronic
917065987 1:171093876-171093898 GGCGCCACTGCCCTCCAGCCTGG - Intronic
917102647 1:171461367-171461389 GGGGCCACTGTGCTCCAGCCTGG + Intergenic
917366903 1:174241274-174241296 GGGGCCACTTCACTCCAGCCTGG + Intronic
917723738 1:177810986-177811008 GGTGCCCTTCACCTTCTGCCAGG - Intergenic
917800588 1:178566081-178566103 TGGGCCACTGAACTCCAGCCTGG - Intergenic
917843560 1:179002234-179002256 GGTGCCACTGCACTTCAGCCTGG + Intergenic
917872135 1:179251386-179251408 GGAGCCACTGCACTTCAGCCTGG - Intergenic
918031610 1:180818991-180819013 GGGGCCACTGTACTCCAGCCTGG - Intronic
918262097 1:182805385-182805407 GGCGCCACTGCCCTCCAGCCTGG + Intronic
919634110 1:199987493-199987515 GGAGCCACTGCACTTCAGCCTGG - Intergenic
919699954 1:200621414-200621436 GGGGCCACTGCACTCCAGCCTGG - Intergenic
919727464 1:200893625-200893647 AGGGCCCCTCAGCCTCAGCCTGG + Intronic
919999856 1:202789491-202789513 GGCGCCACTGAACTCCAGCCTGG + Intronic
920104609 1:203543192-203543214 GGCGCCACTGAACTCCAGCCTGG - Intergenic
920325218 1:205157716-205157738 GGTGCCACTGCACTTCAGCCTGG + Intronic
920828298 1:209443022-209443044 CGTGCCACTGCCCTTCAGCCTGG + Intergenic
920835823 1:209509858-209509880 GGGGCCACTGCACTCCAGCCTGG + Intergenic
920944552 1:210516024-210516046 GGGGCCACTATACTCCAGCCTGG + Intronic
921030712 1:211333230-211333252 GGCGCCACTGCCCTCCAGCCTGG - Intronic
921071983 1:211668000-211668022 GGTGCCACTGCACTTCAGCCTGG + Intronic
921349493 1:214221322-214221344 GGTGCCACTGAACTCCAGCCTGG - Intergenic
921598835 1:217085532-217085554 GGCGCCACTGCACTTCAGCCTGG - Intronic
921834581 1:219764596-219764618 GGTGCCACTGCACTTCAGCCTGG + Intronic
922300490 1:224295234-224295256 GGTGCCACTGCACTTCAGCCTGG - Intronic
922335821 1:224617433-224617455 GCGGCCCCTCGCCTCCAGCCAGG - Intronic
922419341 1:225449035-225449057 GGCGCCACTGACCTTCAGCCTGG - Intergenic
922456823 1:225780421-225780443 GGCGCCACTGCCCTCCAGCCTGG - Intronic
922521072 1:226252920-226252942 GGCGCCACTGAACTCCAGCCTGG + Intronic
922577764 1:226674241-226674263 GGTGCCACTGCCCTCCAGCCTGG - Intronic
922623928 1:227018088-227018110 GGTGCCACTACACTTCAGCCTGG - Intronic
922663969 1:227453336-227453358 GGTGCCACTGCACTTCAGCCTGG + Intergenic
922937486 1:229433253-229433275 GGAGCCACTCAAATTCTGCCAGG + Intronic
922938875 1:229443770-229443792 GGTGCCACTGCACTTCAGCCTGG - Intronic
922945639 1:229511426-229511448 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
923181612 1:231525840-231525862 AGCGCCACTGACCTCCAGCCTGG - Intergenic
923347373 1:233067515-233067537 GGTGCCACTGCACTTCAGCCCGG - Intronic
923432809 1:233939409-233939431 GGTGCCACTCCACTCCAGCCTGG + Intronic
923624939 1:235606336-235606358 CGTGCCACTGAACTTCAGCCTGG + Intronic
923966070 1:239140505-239140527 GGGGCCACTGCACTCCAGCCTGG + Intergenic
924035872 1:239936431-239936453 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
924169195 1:241319566-241319588 GGTGCCACTGAACTCCAGCCTGG - Intronic
924194158 1:241587498-241587520 GAGGCCACTGAACTTCAGCCTGG - Intronic
924559484 1:245145961-245145983 GGGGCCACTGCACTCCAGCCTGG - Intergenic
924570802 1:245235971-245235993 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1062993909 10:1847301-1847323 GAGGCCACCCACCTGCAGGCAGG + Intergenic
1063104246 10:2979027-2979049 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1063122630 10:3115399-3115421 CGGGACACACACCTTCACCCCGG - Intronic
1063122644 10:3115446-3115468 CGGGACACACACCTTCACCCCGG - Intronic
1063122668 10:3115540-3115562 AGGGACACACACCTTCACCCTGG - Intronic
1063122679 10:3115587-3115609 CGGGACACACACCTTCACCCTGG - Intronic
1063297112 10:4817836-4817858 GGGGCCATCCACCTTCAGCAGGG - Intronic
1063525837 10:6784564-6784586 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1063877485 10:10495233-10495255 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1063929866 10:11018153-11018175 GGCGCCACTCACATTCTGTCAGG - Exonic
1063969315 10:11370460-11370482 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1064082091 10:12316517-12316539 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1064115322 10:12572584-12572606 AGGGCCCCTCCCCTCCAGCCAGG - Intronic
1064174737 10:13064742-13064764 GGGGCCACTGCACTCCAGCCTGG + Intronic
1064190161 10:13198937-13198959 GGCGCCACTGCACTTCAGCCTGG - Intronic
1064318432 10:14279230-14279252 GGCGCCACTCTACTCCAGCCTGG - Intronic
1064405041 10:15054080-15054102 TGCGCCACTGAACTTCAGCCTGG - Intronic
1064584603 10:16827643-16827665 GGCGCCACTCCACTCCAGCCTGG - Intronic
1064632990 10:17336635-17336657 CGGGCCACTGCACTTCAGCCTGG - Intronic
1064648434 10:17483862-17483884 CGTGCCACTCAACTCCAGCCTGG - Intergenic
1064660663 10:17604747-17604769 TGCGCCACTGCCCTTCAGCCAGG - Intronic
1064737167 10:18393982-18394004 TGTGCCACTGAACTTCAGCCTGG - Intronic
1065003327 10:21357031-21357053 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1065086801 10:22186987-22187009 AGGGCCACTGAGCTCCAGCCTGG - Intergenic
1065191758 10:23218181-23218203 GGCGCCACTGCACTTCAGCCTGG - Intronic
1065264874 10:23964597-23964619 GGTGCCACTGAACTCCAGCCTGG - Intronic
1065273060 10:24056282-24056304 CGCGCCACTCCACTTCAGCCTGG + Intronic
1065311807 10:24423501-24423523 GGTGCCACTGCACTTCAGCCTGG - Intronic
1065510291 10:26471726-26471748 TGCGCCACTGACCTCCAGCCTGG - Intronic
1065613774 10:27499692-27499714 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1065731026 10:28709894-28709916 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1065930603 10:30475544-30475566 GGGGCCACTGCACTTCAGCCTGG + Intergenic
1066100691 10:32115815-32115837 GGCGCCACTACCCTTCAGCCTGG - Intergenic
1066132214 10:32405192-32405214 GGAGCCACTGCCCTCCAGCCTGG + Intergenic
1066215329 10:33280925-33280947 GGCACCACTGAACTTCAGCCTGG + Intronic
1066426172 10:35309464-35309486 GGTGCCACTGCACTTCAGCCCGG - Intronic
1067228929 10:44393501-44393523 GGGGCCTCACCCCTGCAGCCAGG - Intergenic
1067608070 10:47684627-47684649 CGGGCCACTGCCCTCCAGCCTGG - Intergenic
1068091208 10:52434804-52434826 GGCGCCACTGCACTTCAGCCAGG - Intergenic
1068460604 10:57323501-57323523 GAGGCCGCTTACCTTCTGCCTGG - Intergenic
1068530987 10:58186508-58186530 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1069094318 10:64239956-64239978 GGTTTCACTCATCTTCAGCCTGG + Intergenic
1069150250 10:64951271-64951293 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1069384759 10:67874234-67874256 CGCGCCACTGCCCTTCAGCCTGG + Intergenic
1069696647 10:70391312-70391334 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1070047588 10:72854246-72854268 GGTGCCACTGAACTCCAGCCTGG + Intronic
1070166199 10:73899859-73899881 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1070242448 10:74696407-74696429 CGGGCCACTGAACTCCAGCCTGG - Intronic
1070331716 10:75422340-75422362 TGGGCCACTGCACTTCAGCCTGG - Intergenic
1070590801 10:77799650-77799672 TGTGCCACTCCACTTCAGCCTGG - Intronic
1070840778 10:79486532-79486554 TGGGCCACTGCACTTCAGCCTGG - Intergenic
1070848079 10:79540152-79540174 GGTGCCACTGTACTTCAGCCTGG + Intergenic
1070925699 10:80220017-80220039 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1071012061 10:80950993-80951015 GGGGCTACTGAACTGCAGCCAGG + Intergenic
1071037618 10:81266191-81266213 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1071579176 10:86754926-86754948 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1071591855 10:86882377-86882399 TGGGCCACTGAACTCCAGCCTGG + Intronic
1071706537 10:88005679-88005701 CGTGCCACTGAACTTCAGCCTGG - Intergenic
1072020528 10:91394993-91395015 GAGGACACTGACCTTCAGCCTGG + Intergenic
1072046087 10:91656486-91656508 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1072060707 10:91807950-91807972 TGGGCCACTGCACTTCAGCCTGG + Intronic
1072147051 10:92651068-92651090 CGTGCCACTCCACTTCAGCCTGG - Intronic
1072251174 10:93583370-93583392 GGCGCCACTGCACTTCAGCCTGG + Intronic
1072481632 10:95814625-95814647 GGGTCCACTCAGTATCAGCCAGG + Intronic
1072653025 10:97310287-97310309 CGGGCCACTGAACTCCAGCCTGG + Intergenic
1072997190 10:100255717-100255739 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1073123309 10:101134820-101134842 GGGGCCACAGACCCTCTGCCGGG - Intronic
1073361286 10:102901235-102901257 GGGGCCACTGCACTTCAGCCTGG - Exonic
1073624655 10:105084772-105084794 GGCGCCACTGCACTTCAGCCTGG - Intronic
1073962115 10:108944362-108944384 TGTGCCACTGAACTTCAGCCTGG - Intergenic
1074124093 10:110514523-110514545 GGGGCCACTGCGCTCCAGCCTGG - Intergenic
1074608192 10:114995083-114995105 GGTGCCACTAAACTCCAGCCTGG - Intergenic
1074956989 10:118400767-118400789 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1074997353 10:118769553-118769575 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1075140388 10:119828801-119828823 CGTGCCACTGACCTCCAGCCTGG + Exonic
1075215654 10:120531130-120531152 GGTGCCACTGCACTTCAGCCTGG - Intronic
1075335168 10:121603670-121603692 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1075515376 10:123104150-123104172 GTGGCGACTCACCTGCAGGCAGG + Intergenic
1075759970 10:124848372-124848394 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1075962807 10:126584074-126584096 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1076126530 10:127978495-127978517 CGTGCCACTGAACTTCAGCCTGG + Intronic
1076681054 10:132171375-132171397 AGGGCCCCTCACCCACAGCCCGG + Intronic
1076874159 10:133207854-133207876 GGGCCCACTCACCTCCACCAGGG + Intronic
1076922321 10:133460577-133460599 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1077002253 11:329999-330021 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1077030979 11:467145-467167 GGGGCCACTGCACTCCAGCCTGG + Intronic
1077290447 11:1787850-1787872 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1077341094 11:2026697-2026719 GGCCCCACTCACTGTCAGCCTGG + Intergenic
1077621490 11:3728693-3728715 GGGGCCACTGCACTCCAGCCTGG + Intronic
1077765547 11:5156367-5156389 GGGGCCACTGCACTCCAGCCTGG - Intronic
1077824772 11:5794507-5794529 CGGGCCACTGCCCTCCAGCCTGG - Intronic
1078056050 11:8009740-8009762 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1078330596 11:10416197-10416219 GGTGCCACTGCACTTCAGCCTGG + Intronic
1079036859 11:17027470-17027492 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1079118484 11:17656725-17656747 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1079441803 11:20522431-20522453 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1079871444 11:25803031-25803053 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1079878644 11:25894195-25894217 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1079910410 11:26302449-26302471 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1080161554 11:29182553-29182575 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1080765704 11:35295089-35295111 GGTGCCACTGAGCTCCAGCCTGG - Intronic
1081186676 11:40051334-40051356 AGGGCCACTGCCCTCCAGCCTGG + Intergenic
1081463715 11:43297160-43297182 CGGGCCACTGCCCTCCAGCCTGG - Intergenic
1081657535 11:44867440-44867462 CGGGCCACTCCACTCCAGCCTGG - Intronic
1081935157 11:46899073-46899095 AGGGCCCCTCTCCTTCATCCAGG - Intronic
1081954391 11:47077241-47077263 TGGGCCACTGAACTCCAGCCTGG - Intronic
1082016522 11:47492686-47492708 GGGGCCACTGCACTCCAGCCTGG + Intronic
1082102434 11:48184041-48184063 TGTGCCACTCAACTCCAGCCTGG - Intergenic
1082120982 11:48379402-48379424 GGGGCCAGGCATCTTCAGCATGG - Intergenic
1082275975 11:50222001-50222023 CGTGCCACTGAACTTCAGCCTGG - Intergenic
1082697455 11:56386941-56386963 CGGGCCACTGAACTCCAGCCTGG + Intergenic
1083228022 11:61296696-61296718 GGGGCCACACAGCTTCAGGTAGG - Intergenic
1083229216 11:61304832-61304854 GGGGCCACTGCACTCCAGCCTGG + Intronic
1083239333 11:61374911-61374933 CGCGCCACTGAACTTCAGCCTGG + Intergenic
1083306849 11:61765923-61765945 GGGGCGGCTCAGCTCCAGCCAGG - Intronic
1083348422 11:62010363-62010385 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1083449245 11:62731551-62731573 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1083754059 11:64779697-64779719 GGGGCCACTGCACTTCAGCCTGG + Intergenic
1083779361 11:64910028-64910050 GGGGCCTCTCACCAGCAGGCCGG + Exonic
1083957308 11:65991732-65991754 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1084171692 11:67404126-67404148 GGGGCCACTCCCGGCCAGCCTGG - Intronic
1084717124 11:70881079-70881101 CGGGCCACTTTGCTTCAGCCTGG - Intronic
1085128751 11:74019718-74019740 GGTGCCACTGCACTTCAGCCTGG - Intronic
1085184652 11:74565320-74565342 GGTGCCACTGGACTTCAGCCTGG - Intronic
1085597921 11:77827059-77827081 GGGGCCACTGCACTTCAGCCTGG + Intronic
1085668190 11:78435562-78435584 CGGGCCACTGCCCTCCAGCCTGG - Intergenic
1085885181 11:80513363-80513385 GGTGCCACTACACTTCAGCCTGG - Intergenic
1085929039 11:81058587-81058609 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1086159678 11:83707625-83707647 GGTGCCACTGCACTTCAGCCTGG + Intronic
1086377938 11:86220324-86220346 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1086590688 11:88510558-88510580 GGCGCCACTGCACTTCAGCCTGG - Intronic
1086689168 11:89769136-89769158 TGGGCCACTGGACTTCAGCCTGG + Intergenic
1086716691 11:90070835-90070857 TGGGCCACTGGACTTCAGCCTGG - Intergenic
1086884394 11:92187912-92187934 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1087030595 11:93700467-93700489 GGTGCCACTCTACTCCAGCCTGG - Intronic
1087368691 11:97253265-97253287 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1087579156 11:100029537-100029559 GGCGCCACTGAACTCCAGCCTGG + Intronic
1087692275 11:101335358-101335380 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1087761171 11:102105854-102105876 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1088048944 11:105486903-105486925 TGGGCCACTGCACTTCAGCCTGG + Intergenic
1088255491 11:107899570-107899592 CGGGCCACTCCACTCCAGCCTGG - Intronic
1088288813 11:108213929-108213951 TGAGCCACTCTACTTCAGCCTGG - Intronic
1088328480 11:108626410-108626432 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1088343815 11:108799960-108799982 GGTGCCACTGCGCTTCAGCCTGG - Intronic
1088459172 11:110064582-110064604 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1088647789 11:111930895-111930917 GGTGCCACTGAACTCCAGCCTGG - Intronic
1089742808 11:120596766-120596788 GGCGCCACTGCACTTCAGCCTGG - Intronic
1089912696 11:122118240-122118262 TGCGCCACTGACCTCCAGCCTGG - Intergenic
1089969794 11:122683559-122683581 TGCGCCACTGCCCTTCAGCCTGG + Intronic
1090297222 11:125599453-125599475 TGAGCCACTGAACTTCAGCCTGG - Intronic
1090365311 11:126200427-126200449 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1090534822 11:127629195-127629217 TGGGCCACTACACTTCAGCCTGG + Intergenic
1202824079 11_KI270721v1_random:81886-81908 GGCCCCACTCACTGTCAGCCTGG + Intergenic
1091889872 12:4045009-4045031 GGGGCCTCTCACTTTCAGGATGG - Intergenic
1092279719 12:7090044-7090066 GGGGCTACTCACCCACAGCTTGG + Exonic
1092345075 12:7708135-7708157 TGGGCCACTGCACTTCAGCCTGG - Intergenic
1092353989 12:7779410-7779432 GAGGCCACTGCACTTCAGCCTGG - Intergenic
1092448337 12:8578960-8578982 CGGGCCACTGAACTCCAGCCTGG + Intergenic
1092466963 12:8741734-8741756 GGCGCCACTGCACTTCAGCCTGG + Intronic
1092519535 12:9253686-9253708 GGTGGCTCTCACCTTCAGGCGGG + Intergenic
1092526120 12:9311280-9311302 CAGGCCACTCACCTTCTTCCTGG - Intergenic
1092541160 12:9420503-9420525 CAGGCCACTCACCTTCTTCCTGG + Intergenic
1092647066 12:10586542-10586564 GGTGCCACTCTACTCCAGCCTGG + Intergenic
1092695552 12:11167486-11167508 GGGGCCACTGCACTCCAGCCTGG - Intronic
1092826240 12:12402020-12402042 GGCGCCACTGCACTTCAGCCTGG + Intronic
1092863635 12:12741248-12741270 GGTGCCACTGCCCTCCAGCCAGG - Intronic
1093360878 12:18226248-18226270 GGCGCCACTGAACTCCAGCCTGG + Intronic
1093470776 12:19499568-19499590 GGCGCCACTGCACTTCAGCCTGG + Intronic
1093927417 12:24922824-24922846 GGGGCCACTGAACTCCAGTCTGG + Intronic
1094017576 12:25881292-25881314 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1094129061 12:27055156-27055178 TGGGCCACTGCACTTCAGCCTGG + Intronic
1094194774 12:27736918-27736940 TGTGCCACTGACCTCCAGCCTGG - Intronic
1094377545 12:29806811-29806833 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1094439891 12:30463384-30463406 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1094511883 12:31101972-31101994 CAGGCCACTCACCTTCTTCCTGG - Exonic
1094544385 12:31390970-31390992 GGGGCCACTGCACTCCAGCCTGG + Intronic
1094567269 12:31610838-31610860 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1094588832 12:31801929-31801951 GGTGCCACTCTACTCCAGCCTGG + Intergenic
1094595172 12:31858955-31858977 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1094611729 12:32001411-32001433 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1094614515 12:32024075-32024097 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1094669500 12:32555613-32555635 GGCGCCACTGCACTTCAGCCTGG - Intronic
1095170773 12:39033513-39033535 GGCGCCACTTAACTCCAGCCTGG - Intergenic
1095473759 12:42564562-42564584 GGTGCCACTGCACTTCAGCCTGG + Intronic
1095695766 12:45142671-45142693 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1095901392 12:47332163-47332185 GGAGCCACTGCCCTCCAGCCTGG + Intergenic
1096005466 12:48166819-48166841 GGTGCCACTGCACTTCAGCCTGG + Intronic
1096295866 12:50383550-50383572 CGCGCCACTCAACTCCAGCCTGG + Intronic
1096300112 12:50419319-50419341 GGTGCCACTGCACTTCAGCCTGG + Intronic
1096430522 12:51539210-51539232 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1096533301 12:52255338-52255360 GGGGTCACTCACCTTCTTCAAGG + Intronic
1096697110 12:53356552-53356574 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1097016239 12:55989316-55989338 GGCGCCACTGCACTTCAGCCTGG - Intronic
1097169261 12:57103609-57103631 TGCGCCACTGCCCTTCAGCCTGG - Intronic
1097390282 12:59003653-59003675 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1097668897 12:62513267-62513289 GGGGCCACTGCACTCCAGCCTGG - Intronic
1097806002 12:63965860-63965882 GGTGCCACTGCACTTCAGCCTGG - Intronic
1097851727 12:64417484-64417506 GGTGCCACTGCACTTCAGCCTGG + Intronic
1098311343 12:69152133-69152155 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1098343180 12:69472128-69472150 GGGGCCACTGTGCTGCAGCCTGG - Intronic
1098417890 12:70257402-70257424 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1099095561 12:78370889-78370911 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1099369325 12:81811220-81811242 GGGAACACTCACCACCAGCCAGG + Intergenic
1099536536 12:83853069-83853091 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1099668350 12:85659522-85659544 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1099723798 12:86399012-86399034 GGCGCCACTGCACTTCAGCCTGG - Intronic
1099789784 12:87318825-87318847 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1100304259 12:93336186-93336208 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1100548103 12:95622364-95622386 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1100575898 12:95891387-95891409 GGTGCCACTGAACTCCAGCCTGG - Intronic
1100629165 12:96369733-96369755 GGGGCCACTGGGCTCCAGCCTGG + Intronic
1100743416 12:97619841-97619863 CGTGCCACTGAACTTCAGCCTGG + Intergenic
1100836114 12:98568713-98568735 GGCGCCACTGTACTTCAGCCTGG + Intergenic
1101335625 12:103794191-103794213 GGGACCACTGCACTTCAGCCTGG - Intronic
1101414100 12:104493865-104493887 GGTGCCACTGCACTTCAGCCTGG - Intronic
1101426809 12:104594901-104594923 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1101461541 12:104901591-104901613 GGGGCCACTGCACTCCAGCCTGG - Intronic
1101667490 12:106832521-106832543 GGGGCCACTGCACTCCAGCCTGG + Intronic
1101681264 12:106968330-106968352 CGTGCCACTGAACTTCAGCCTGG + Intronic
1101904541 12:108814884-108814906 CGGGCCAGTCTCCTCCAGCCAGG + Intronic
1102386485 12:112514709-112514731 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1102389232 12:112536232-112536254 GGTGCCACTGAACTGCAGCCTGG + Intergenic
1102533736 12:113565794-113565816 TGGGCCTCTGACCTTCAGCCAGG + Intergenic
1102932231 12:116871344-116871366 CGTGCCACTGAACTTCAGCCTGG - Intronic
1103372534 12:120430382-120430404 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1103469387 12:121167854-121167876 GGCGCCACTGCACTTCAGCCTGG - Intronic
1103494622 12:121352122-121352144 GGCGCCTCTCACCTGCAGCAGGG + Exonic
1103513652 12:121492349-121492371 GGCGCCACTGCACTTCAGCCTGG - Intronic
1103525410 12:121564412-121564434 GGCGCCACTGCACTTCAGCCTGG + Intronic
1103525939 12:121568414-121568436 GGTGCCACTGCACTTCAGCCTGG + Intronic
1103529174 12:121588481-121588503 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1103533329 12:121617752-121617774 GGGGCCACTACACTTCAGCCTGG - Intergenic
1103551900 12:121744029-121744051 AGAGACACTCTCCTTCAGCCAGG - Intronic
1103577665 12:121890509-121890531 GGTGCCACTGAACTCCAGCCTGG - Intronic
1103609182 12:122111031-122111053 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1104207742 12:126656623-126656645 GGGGCCACTGCCCTCCAGCTTGG - Intergenic
1104247350 12:127056422-127056444 AGTGCCACTCAACTCCAGCCTGG - Intergenic
1104324507 12:127783730-127783752 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1104358231 12:128107420-128107442 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1104455788 12:128911229-128911251 CGTGCCACCCACCTTCTGCCTGG + Intronic
1104819900 12:131670599-131670621 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1105034061 12:132905527-132905549 GGGGCCACTGCACTCCAGCCGGG + Intronic
1105050479 12:133045425-133045447 TGGGCCACTGCACTTCAGCCTGG + Intronic
1105403584 13:20116011-20116033 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1105476298 13:20730543-20730565 GGTGCCACTGCACTTCAGCCTGG - Intronic
1105511982 13:21059919-21059941 CGCGCCACTCCCCTCCAGCCTGG + Intronic
1105649197 13:22355635-22355657 CGCGCCACTGCCCTTCAGCCTGG + Intergenic
1105700993 13:22935630-22935652 GGGGACAGACACCTTCAGGCTGG - Intergenic
1105801998 13:23914297-23914319 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1105853822 13:24358679-24358701 GGGGACAGACACCTTCAGGCTGG - Intergenic
1105875131 13:24545755-24545777 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1106252787 13:27995563-27995585 GGTGCCACTACACTTCAGCCTGG + Intergenic
1106556154 13:30810302-30810324 GGGGCCAGCCTCCTTCAGCTGGG - Intergenic
1106839503 13:33671684-33671706 TGGGCCACTGCTCTTCAGCCTGG + Intergenic
1106986467 13:35358063-35358085 CGTGCCACTGAACTTCAGCCTGG - Intronic
1107378179 13:39827394-39827416 TGGGCCACTGCCCTCCAGCCTGG - Intergenic
1107529359 13:41266951-41266973 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1107530719 13:41279979-41280001 CGGGCCACTGTCCTCCAGCCTGG - Intergenic
1107622593 13:42248380-42248402 GGGGCCACTGCACTCCAGCCTGG + Intronic
1107679972 13:42838257-42838279 GGGGCTATTCACATTCATCCAGG + Intergenic
1107735664 13:43396421-43396443 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1107844574 13:44498252-44498274 GGTGCCACTGCCCTTCAGCCTGG + Intronic
1107874799 13:44780866-44780888 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1108002440 13:45916571-45916593 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1108038777 13:46320336-46320358 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1108320574 13:49285855-49285877 GGTGCCACTGCACTTCAGCCTGG - Intronic
1108380484 13:49849609-49849631 GGTGCCACTGAACTGCAGCCTGG + Intergenic
1108672714 13:52708223-52708245 TGGGCCACTGCACTTCAGCCTGG - Intronic
1109588466 13:64443037-64443059 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1109642602 13:65209912-65209934 TGATCCAATCACCTTCAGCCAGG + Intergenic
1110181208 13:72619440-72619462 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1111115013 13:83764460-83764482 TGGGCCACTGAACTCCAGCCTGG - Intergenic
1111314465 13:86535020-86535042 GGCGCCACTCTACTTCAGCCTGG - Intergenic
1111427541 13:88107142-88107164 TGGGCCACTGCACTTCAGCCTGG + Intergenic
1111738692 13:92174891-92174913 GGGGCCACTGCACTCCAGCCTGG - Intronic
1111936555 13:94563902-94563924 GGCGCCACTACACTTCAGCCTGG - Intergenic
1111953262 13:94728219-94728241 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1112274512 13:98003801-98003823 GGTGCCACTGCCCTTCAACCTGG + Intronic
1112543051 13:100336216-100336238 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1112867388 13:103922312-103922334 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1113004353 13:105681662-105681684 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1113040035 13:106094923-106094945 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1113053409 13:106239822-106239844 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1113158217 13:107349695-107349717 GGGGCCACTGCACTCCAGCCTGG + Intronic
1113199821 13:107854828-107854850 GGCGCCACTGCACTTCAGCCTGG + Intronic
1113426283 13:110211091-110211113 AGGGACTCTCACCTTCATCCAGG + Intronic
1113476467 13:110585507-110585529 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1113616293 13:111683035-111683057 GGGGCCAAACACCTTCAGCTGGG + Intergenic
1113621761 13:111767928-111767950 GGGGCCAAACACCTTCAGCTGGG + Intergenic
1114006830 14:18322719-18322741 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1114147921 14:19999441-19999463 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1114293241 14:21306173-21306195 GGTGCCACTACACTTCAGCCTGG - Intronic
1114471140 14:22963451-22963473 GGTGCCACTGCACTTCAGCCTGG - Intronic
1114569234 14:23654354-23654376 GGGGCCAACCACCTCCCGCCAGG - Intergenic
1114640277 14:24215127-24215149 GGAGCCACTGCACTTCAGCCTGG - Intronic
1114775258 14:25474093-25474115 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1114959123 14:27861617-27861639 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1115030562 14:28788273-28788295 TGTGCCACTGACCTCCAGCCTGG + Intronic
1115031185 14:28795723-28795745 GGTGCCACTGCACTTCAGCCTGG + Intronic
1115210315 14:30960823-30960845 GGTGCCACTGCACTTCAGCCTGG + Intronic
1115332659 14:32214582-32214604 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1115496951 14:34014415-34014437 GGCGCCACTGAACTCCAGCCTGG - Intronic
1115541293 14:34424016-34424038 GGTTCCACTGAACTTCAGCCTGG - Intronic
1115606697 14:35010102-35010124 CGTGCCACTACCCTTCAGCCTGG + Intronic
1116124967 14:40772392-40772414 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1116268323 14:42726009-42726031 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
1116504632 14:45663827-45663849 TGGGCCACTGCACTTCAGCCTGG - Intergenic
1116643577 14:47497298-47497320 TGGGCCACTGCCCTTCAGCCTGG - Intronic
1116814601 14:49571992-49572014 GGTGCCACTGCACTTCAGCCTGG - Exonic
1116851532 14:49914011-49914033 GGTGCCACTACACTTCAGCCTGG - Intergenic
1116854378 14:49938762-49938784 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1116970000 14:51054314-51054336 GGAGCCACTATACTTCAGCCTGG - Intronic
1116988121 14:51242731-51242753 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1117128551 14:52659875-52659897 GGAGCCACTGCCCTCCAGCCTGG - Intronic
1117557172 14:56897536-56897558 TGTGCCACTGCCCTTCAGCCTGG - Intergenic
1117687668 14:58271371-58271393 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1117779543 14:59218087-59218109 TGGGCCACTGTACTTCAGCCTGG + Intronic
1117796284 14:59397541-59397563 TGTGCCACTGAACTTCAGCCTGG - Intergenic
1118185288 14:63531907-63531929 GGGGCCACTGCACTCCAGCCTGG + Intronic
1118474067 14:66100988-66101010 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1118746495 14:68777211-68777233 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1119226014 14:72945043-72945065 GGTGCCACTGTACTTCAGCCTGG + Intronic
1119515043 14:75241355-75241377 GGTGCCACTGAACTCCAGCCTGG - Intronic
1119599273 14:75963918-75963940 GGGGCCACTGCACTCCAGCCTGG - Intronic
1119741969 14:77019592-77019614 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1120601666 14:86517671-86517693 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1120920673 14:89752511-89752533 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1121223289 14:92302474-92302496 GGCGCCACTGTGCTTCAGCCTGG + Intergenic
1121572954 14:94961357-94961379 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1121769656 14:96522163-96522185 GGTGCCACTGTACTTCAGCCTGG - Intronic
1121784139 14:96642373-96642395 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1121876016 14:97453863-97453885 GGTGCCACTCAACTCAAGCCTGG + Intergenic
1121975359 14:98398545-98398567 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1122032470 14:98922998-98923020 GGAGCCACTGCACTTCAGCCTGG - Intergenic
1122114114 14:99519157-99519179 GGTGCCACTGTACTTCAGCCTGG - Intronic
1122186013 14:99996693-99996715 TGTGCCACTGACCTCCAGCCTGG - Intronic
1122677187 14:103425301-103425323 GGTGCCACTGAACTCCAGCCTGG - Intronic
1122739695 14:103864899-103864921 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1122743377 14:103884547-103884569 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1122750581 14:103929561-103929583 GGCGCCACTCCACTCCAGCCTGG - Intronic
1122754483 14:103967479-103967501 TGTGCCACTGCCCTTCAGCCTGG + Intronic
1122774663 14:104111866-104111888 GGGGCCACTGACTAGCAGCCTGG - Intronic
1122842602 14:104473682-104473704 GGGGTCAGCCACCTTCAGGCTGG - Intergenic
1122902735 14:104788502-104788524 CAGGCCACTCCCCTTCATCCTGG - Intronic
1122911270 14:104828926-104828948 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1122912057 14:104835354-104835376 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1122966952 14:105135438-105135460 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1123015600 14:105372856-105372878 GGGGCCACTGCACTCCAGCCTGG + Intronic
1123519626 15:21059978-21060000 CATGCCACTGACCTTCAGCCTGG - Intergenic
1123701074 15:22915172-22915194 CGCGCCACTCACCTCCAGCCTGG - Intronic
1124089684 15:26586637-26586659 GGGGCCACTGCACTCCAGCCTGG + Intronic
1124435292 15:29643735-29643757 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1124453355 15:29818858-29818880 GGGGCCACTGCACTACAGCCTGG - Intronic
1124640725 15:31394441-31394463 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1124698161 15:31884916-31884938 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1124905299 15:33862652-33862674 GGCGCCACTGCACTTCAGCCTGG - Intronic
1124912578 15:33937085-33937107 CGCGCCACTGCCCTTCAGCCTGG + Intronic
1124924814 15:34060824-34060846 GGTGCCACTACACTTCAGCCTGG + Intronic
1125012517 15:34895116-34895138 GGTGCCACTACACTTCAGCCTGG + Intronic
1125385858 15:39135843-39135865 TGGGCCACTGAACTCCAGCCTGG - Intergenic
1125468341 15:39976992-39977014 CGCGCCACTGACCTCCAGCCTGG - Intronic
1125592426 15:40863133-40863155 GTGGCCCCTCACCTTCTGCCTGG - Intergenic
1125594424 15:40875185-40875207 TGGGCCACTCCACTCCAGCCTGG + Intergenic
1125762881 15:42109723-42109745 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1125806329 15:42496671-42496693 CGTGCCACTGAGCTTCAGCCTGG + Intronic
1125913306 15:43461710-43461732 GGTGCCACTGCACTTCAGCCTGG - Intronic
1126002456 15:44223920-44223942 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1126049194 15:44671443-44671465 GGTGCCACTGCACTTCAGCCTGG + Intronic
1126189759 15:45867162-45867184 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1126259196 15:46668193-46668215 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1126683433 15:51226043-51226065 GGGGCCACTGCACTCCAGCCTGG + Intronic
1127139622 15:55961512-55961534 GGGGCCACTGCACTCCAGCCTGG - Intronic
1127334103 15:57966797-57966819 AGGGCCACTCCCCTTCAGCAGGG + Intronic
1127433974 15:58938393-58938415 TGTGCCACTCCCCTCCAGCCTGG - Intronic
1127439709 15:58994079-58994101 GGGGCCACTGCACTCCAGCCTGG - Intronic
1127445113 15:59053977-59053999 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1127785852 15:62354157-62354179 GGAGCCACTGCACTTCAGCCTGG - Intergenic
1127856266 15:62956247-62956269 GGCGCCACTCTACTCCAGCCTGG + Intergenic
1127986973 15:64080636-64080658 GGCGCCACTGAACTCCAGCCTGG + Intronic
1128125180 15:65186831-65186853 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1128150881 15:65362896-65362918 GGGGCCACTGCACTCCAGCCTGG - Intronic
1128155511 15:65389272-65389294 GGAGCCACTCACGGTCAGGCAGG + Exonic
1128171723 15:65519382-65519404 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1128189593 15:65679136-65679158 GGGGCCACTGCACTCCAGCCCGG - Intronic
1128404302 15:67319181-67319203 GGGGCCACTGCACTCCAGCCTGG + Intronic
1128630409 15:69260301-69260323 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1129307991 15:74682572-74682594 GGGGCCACTGCACTCCAGCCTGG + Intronic
1129353463 15:74971396-74971418 GGTGCCACTGCACTTCAGCCTGG - Intronic
1129634185 15:77297713-77297735 GGCGCCACTGCACTTCAGCCTGG + Intronic
1129755702 15:78097830-78097852 GGGACCCCTCACCTGCACCCAGG + Intronic
1130071444 15:80649744-80649766 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1130878370 15:88033352-88033374 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1130954316 15:88616135-88616157 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1131237056 15:90705849-90705871 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1131286491 15:91063244-91063266 GGTGCCACTACCCTCCAGCCTGG + Intergenic
1131373498 15:91904076-91904098 GGGGCACCTCACCTCCACCCAGG - Intronic
1131894626 15:97012867-97012889 GGGGCCAGTCTCCAACAGCCTGG - Intergenic
1131952527 15:97696243-97696265 GGCACCACTGCCCTTCAGCCTGG - Intergenic
1132052294 15:98617006-98617028 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1132116234 15:99138355-99138377 GGGGCCACTGCACTCCAGCCTGG - Intronic
1132202047 15:99961736-99961758 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1132407467 15:101552498-101552520 GGGGACACTTTCCTTCTGCCTGG + Intergenic
1132596784 16:755104-755126 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1132649653 16:1014680-1014702 CGTCCCACTCACCTCCAGCCTGG - Intergenic
1132676009 16:1121563-1121585 GGGACCATTCAGCTTCAGCCAGG + Intergenic
1132752231 16:1463816-1463838 GGTGCCACTGCACTTCAGCCTGG - Intronic
1132881060 16:2161916-2161938 AGTGCCACACACCTGCAGCCAGG - Intronic
1132917936 16:2364047-2364069 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1133016536 16:2944776-2944798 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1133060187 16:3170030-3170052 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1133224437 16:4333983-4334005 CGGGCCACTGGCCTCCAGCCTGG - Intronic
1133263238 16:4565884-4565906 GGCACCACTGAACTTCAGCCAGG - Intronic
1133345649 16:5068580-5068602 GGGGCCACTGCACTGCAGCCTGG + Intronic
1133419505 16:5633807-5633829 GAGGCCACTGTCCTCCAGCCTGG + Intergenic
1133536368 16:6705972-6705994 GGTGCCACTGAACTCCAGCCTGG + Intronic
1134072128 16:11266867-11266889 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1134122369 16:11594140-11594162 GGCGCCACTGCACTTCAGCCTGG + Intronic
1134131790 16:11655272-11655294 GGTGCCACTATACTTCAGCCTGG + Intergenic
1134168458 16:11949111-11949133 CGGGCCACTCTACTCCAGCCTGG + Intronic
1134830476 16:17318829-17318851 CGTGCCACTGCCCTTCAGCCTGG - Intronic
1135079837 16:19424603-19424625 GGCGCCATTGCCCTTCAGCCTGG + Intronic
1135582916 16:23643233-23643255 GGGGCCACTGCACTCCAGCCTGG - Intronic
1135654968 16:24240016-24240038 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1135665524 16:24332419-24332441 TGTGCCACTGCCCTTCAGCCTGG + Intronic
1135896928 16:26414488-26414510 GGGACCACTCCACTCCAGCCTGG + Intergenic
1135905498 16:26508151-26508173 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1136001822 16:27300397-27300419 GGCGCCACTGGCCTCCAGCCTGG - Intergenic
1136040855 16:27577646-27577668 CGGGCCACTGCTCTTCAGCCTGG + Intronic
1136043684 16:27599668-27599690 GTAGCCTCTCACCTGCAGCCTGG + Intronic
1136491623 16:30612246-30612268 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1136495956 16:30644417-30644439 GGAGCCACTGAACTCCAGCCTGG - Intergenic
1136609401 16:31357091-31357113 AGGGCCACTCACCAGCAGCTGGG - Exonic
1137985349 16:53102804-53102826 GGTGCCACTGAACTCCAGCCTGG + Intronic
1138014935 16:53419768-53419790 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1138174233 16:54882196-54882218 GGAGCCACTGAACTCCAGCCTGG + Intergenic
1138418809 16:56886385-56886407 GGGGCCCCCCAACTTCCGCCCGG + Exonic
1138424269 16:56920187-56920209 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1138548406 16:57733885-57733907 GGGGCCACTGTACTCCAGCCTGG - Intergenic
1138821219 16:60262187-60262209 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1138822765 16:60281548-60281570 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1139060190 16:63240985-63241007 GGTGCCACTGACTTCCAGCCTGG + Intergenic
1139199934 16:64964590-64964612 GGGGCCACTGCACTCCAGCCTGG - Intronic
1139344015 16:66290400-66290422 GAGGCCACCCACATTCTGCCAGG + Intergenic
1139494616 16:67307355-67307377 TGGGCCACTGCCCTCCAGCCTGG - Intronic
1139602662 16:67995918-67995940 TGGGCCACTGAACTTCAGCCTGG + Intronic
1139643757 16:68312264-68312286 GGCGCCACTGAACTCCAGCCTGG - Intronic
1139722086 16:68864535-68864557 CGGGCCACTGCACTTCAGCCTGG + Intronic
1139733506 16:68968107-68968129 GGCGCCACTGCACTTCAGCCTGG - Intronic
1139746869 16:69082016-69082038 GGCGCCACTGAACTCCAGCCTGG - Intronic
1139766225 16:69232553-69232575 GGGGCCACTGCACTCCAGCCTGG - Intronic
1139769976 16:69266318-69266340 GGGGCCATTGTCCTCCAGCCTGG + Intronic
1139869686 16:70096746-70096768 GGTGCCACTGCCCTTCAGCCTGG + Intergenic
1140081758 16:71754754-71754776 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1140281893 16:73562550-73562572 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1140385697 16:74535474-74535496 GGTGCCACTGCCCTTCAGCCTGG - Intronic
1140533904 16:75691548-75691570 GGTGCCACTCCACTCCAGCCTGG + Intronic
1140544684 16:75795740-75795762 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1140546235 16:75812450-75812472 GGTGCCACTACCCTCCAGCCTGG - Intergenic
1140790321 16:78385088-78385110 GGTGCCACTGCACTTCAGCCTGG + Intronic
1140822724 16:78678330-78678352 CGGGCCACTGCACTTCAGCCTGG + Intronic
1141347006 16:83256075-83256097 GGTGCCACTGTACTTCAGCCTGG - Intronic
1141482672 16:84317247-84317269 CGTGCCACTACCCTTCAGCCTGG + Intronic
1141508257 16:84495223-84495245 CGCGCCACTCAACTCCAGCCTGG + Intronic
1141510056 16:84506050-84506072 GGTGCCTGTCACCTGCAGCCAGG + Intronic
1141588904 16:85054472-85054494 GTGGCCACTGCACTTCAGCCTGG - Intronic
1141741124 16:85893748-85893770 TGGGCCACTGCACTTCAGCCTGG + Intergenic
1141847139 16:86618532-86618554 GGTGGCACTGCCCTTCAGCCTGG + Intergenic
1141957975 16:87384814-87384836 GGTGCCACTGCACTTCAGCCTGG + Intronic
1142156820 16:88536213-88536235 CGTGCCACTGAACTTCAGCCTGG - Exonic
1142289800 16:89188275-89188297 GGGGCCGCTCACCTTCACAATGG - Exonic
1142290365 16:89191462-89191484 GGCGCCGCTCACCGTCATCCTGG - Exonic
1142315246 16:89340319-89340341 GGTGCCACTGCACTTCAGCCTGG - Intronic
1142362017 16:89631811-89631833 CGGGCCACTGTACTTCAGCCTGG + Intronic
1142511772 17:400465-400487 GGCGCCACTCCACTCCAGCCTGG + Intergenic
1142649518 17:1338574-1338596 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1142678315 17:1529497-1529519 GGCGCCACTCCACTCCAGCCTGG + Intronic
1142818319 17:2445740-2445762 GGTGCCACTCCACTCCAGCCTGG + Intronic
1142968029 17:3592928-3592950 GGGTCCACACATCATCAGCCAGG + Intronic
1143223226 17:5279836-5279858 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1143236250 17:5403431-5403453 GGTGCCACTGCACTTCAGCCTGG + Intronic
1143391713 17:6562692-6562714 GGGGCCACTGTACTCCAGCCTGG - Intergenic
1143636991 17:8170684-8170706 CGCGCCACTGCCCTTCAGCCTGG - Intergenic
1143651898 17:8268594-8268616 GCGGCCAGACACCTTCAGCCTGG + Exonic
1143827977 17:9628321-9628343 GGGGCCACTGCACTCCAGCCTGG - Intronic
1143945302 17:10586470-10586492 CGTGCCACTCAACTCCAGCCTGG - Intergenic
1143970720 17:10793315-10793337 TGCGCCACTCAACTTCAGCCTGG + Intergenic
1144226182 17:13149259-13149281 CGTGCCACTCAACTCCAGCCTGG + Intergenic
1144237695 17:13277987-13278009 TGGACCACTGCCCTTCAGCCTGG + Intergenic
1144437517 17:15254913-15254935 GGCGCCACTGAACTCCAGCCTGG + Intronic
1144467453 17:15507793-15507815 GGCGCCACTGCACTTCAGCCTGG + Intronic
1144469166 17:15521878-15521900 GTGGCCACACTCCTTCAGCTTGG - Intronic
1144477843 17:15604034-15604056 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1144587386 17:16495456-16495478 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1144606965 17:16675223-16675245 GGTGCCACTCCACTCCAGCCTGG + Intergenic
1144612398 17:16733458-16733480 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1144640998 17:16936565-16936587 TGGGCCACTGCACTTCAGCCTGG - Intronic
1144741616 17:17586037-17586059 GGCGCCACTGCACTTCAGCCTGG + Intronic
1144851082 17:18244283-18244305 GGGGCCACTGCACTCCAGCCTGG - Exonic
1144874081 17:18387967-18387989 TGGGCCACTGCACTTCAGCCTGG + Intronic
1144900330 17:18581830-18581852 TGGGCCACTGCCCTCCAGCCTGG - Intergenic
1144927198 17:18821793-18821815 GTGGCCACACTCCTTCAGCTTGG + Intergenic
1144943325 17:18956518-18956540 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1144965909 17:19077275-19077297 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1144982059 17:19174914-19174936 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1144986164 17:19203325-19203347 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1145072702 17:19824401-19824423 GGAGCCACTAAACTCCAGCCTGG + Intronic
1145132115 17:20363850-20363872 TGGGCCACTGCCCTCCAGCCTGG + Intergenic
1145183248 17:20771530-20771552 GGCGCCACTCCACTCCAGCCTGG - Intergenic
1145250372 17:21293921-21293943 GTGGCCATGCACCTTCAGGCAGG - Intronic
1145887606 17:28393505-28393527 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1145945616 17:28772011-28772033 GGCGCCACTGAGCTCCAGCCTGG + Intronic
1146078352 17:29754708-29754730 GGTGCCACTTCACTTCAGCCTGG - Intronic
1146226188 17:31068412-31068434 TGGTCCACTCAGCTTCAGCCAGG - Intergenic
1146576363 17:33995354-33995376 GGGGAGACTCTCCTTCTGCCAGG - Intronic
1146757655 17:35447924-35447946 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1146774854 17:35604712-35604734 GGTGCCACTGAACTCCAGCCTGG + Intronic
1146810192 17:35896970-35896992 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1146999870 17:37354308-37354330 GGGGCCACCAACCTTTAGGCAGG + Intronic
1147047864 17:37768113-37768135 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1147222370 17:38944136-38944158 TGGGCCACTGAACTCCAGCCTGG + Intronic
1147481662 17:40770726-40770748 GGGGCCACTGCACTTCAGTCTGG - Intronic
1147616436 17:41831274-41831296 GGGGCCACTGCACTCCAGCCTGG + Intronic
1147724015 17:42555269-42555291 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1147751566 17:42738130-42738152 GGTGCCACTGAACTCCAGCCTGG + Intronic
1147813750 17:43193164-43193186 GATGGGACTCACCTTCAGCCAGG + Exonic
1147877833 17:43634115-43634137 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1148088433 17:45008277-45008299 GGGGGCCCTCACCTGCAGCTGGG + Intergenic
1148204282 17:45769759-45769781 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1148242257 17:46008138-46008160 GGCGCCACTGAACTCCAGCCTGG - Intronic
1148902093 17:50885970-50885992 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1149618294 17:58020726-58020748 TGCGCCACTGCCCTTCAGCCTGG + Intergenic
1149702374 17:58666003-58666025 TGTGCCACTCAACTCCAGCCTGG + Intronic
1149874558 17:60218338-60218360 CGTGCCACTCCACTTCAGCCTGG + Intronic
1150063700 17:62090990-62091012 CGTGCCACTGACCTCCAGCCTGG - Intergenic
1150067627 17:62124877-62124899 TGGGCCACTGCACTTCAGCCTGG - Intergenic
1150082407 17:62251975-62251997 AGGGCCACTGCACTTCAGCCTGG + Intergenic
1150289949 17:63975361-63975383 GGTGCCACTGTCCTCCAGCCTGG + Intergenic
1150690051 17:67357963-67357985 GGTGCCACTGCACTTCAGCCTGG - Intronic
1150895784 17:69208996-69209018 GGCACCACTCCACTTCAGCCTGG + Intronic
1151009924 17:70482785-70482807 TGGGCCACTCCACTCCAGCCTGG + Intergenic
1151054611 17:71017076-71017098 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1151284166 17:73097765-73097787 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1151301446 17:73230250-73230272 GGGGCCACTGCACTCCAGCCTGG + Intronic
1151438225 17:74111572-74111594 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1151612927 17:75188298-75188320 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1151705416 17:75764700-75764722 GGGGCTCCTCGCCTTCAACCTGG - Intronic
1151720391 17:75852058-75852080 GGCGCCACTGAACTCCAGCCTGG + Intronic
1151762685 17:76115197-76115219 TGGGCCACTGAACTCCAGCCTGG - Intronic
1151834653 17:76574718-76574740 GGGGCCACTGCACTCCAGCCTGG - Intronic
1151836011 17:76583330-76583352 GGGGCCACTGCACTCCAGCCTGG + Intronic
1151905805 17:77048102-77048124 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1151934141 17:77251296-77251318 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG + Exonic
1152336037 17:79700656-79700678 GGGGACACACACATTCAGACTGG - Intergenic
1152359356 17:79823993-79824015 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1152397002 17:80039453-80039475 CGTGCCACTGAACTTCAGCCTGG - Intronic
1152412451 17:80134778-80134800 GGTGCCACTGCTCTTCAGCCTGG + Intergenic
1152672378 17:81616684-81616706 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1152682687 17:81677283-81677305 CGGCCCACCCACCTCCAGCCGGG + Intergenic
1152787886 17:82260914-82260936 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1152917140 17:83046171-83046193 GGTGCCACTGTACTTCAGCCTGG - Intronic
1152986977 18:330032-330054 CGTGCCACTGCCCTTCAGCCTGG + Intronic
1152997511 18:421674-421696 AGTGCCACTCAGCTTCAGTCTGG - Intronic
1153167150 18:2275054-2275076 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1153195508 18:2591796-2591818 GGTGCCACTGCACTTCAGCCTGG - Intronic
1153606822 18:6842321-6842343 TGGGCCACTTAACTCCAGCCTGG + Intronic
1153701544 18:7699450-7699472 CGCGCCACTCTACTTCAGCCTGG - Intronic
1153874409 18:9354997-9355019 GGGGCCACTGCACTCCAGCCTGG - Intronic
1153875248 18:9364564-9364586 GGGGCGAATCACCTTAAGTCAGG + Intronic
1154218612 18:12433467-12433489 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1155247489 18:23924193-23924215 GGCGCCACTGAACTCCAGCCTGG - Intronic
1155438591 18:25837924-25837946 TGTGCCACTGACCTCCAGCCTGG + Intergenic
1155477616 18:26250077-26250099 CGAGCCACTCCACTTCAGCCTGG - Intronic
1155485136 18:26333262-26333284 GGGGCCACTGCACTCCAGCCTGG - Intronic
1156205182 18:34878014-34878036 GGTGCCACTGTACTTCAGCCGGG - Intronic
1156988674 18:43379837-43379859 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1157315914 18:46589473-46589495 GTGTCCACTCACCTGCATCCTGG - Intronic
1157774209 18:50378629-50378651 GGTGCCACTGAACTCCAGCCTGG + Intronic
1158039745 18:53078245-53078267 GGGGCCACTGCACTCCAGCCTGG + Intronic
1158377077 18:56883164-56883186 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1158480609 18:57818316-57818338 GAGACCACTGACCTGCAGCCTGG - Intergenic
1158489145 18:57894521-57894543 CGTGCCACTGCCCTTCAGCCTGG - Intergenic
1158496013 18:57955782-57955804 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1158547219 18:58406601-58406623 CGCGCCACTGACCTCCAGCCTGG - Intergenic
1158616099 18:58988325-58988347 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1158674734 18:59507932-59507954 CGTGCCACTGCCCTTCAGCCTGG - Intronic
1159504046 18:69311233-69311255 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1159710402 18:71751081-71751103 GGTGCCACTGCTCTTCAGCCTGG + Intronic
1159728709 18:71997309-71997331 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1159789995 18:72766160-72766182 TGTGCCACTGCCCTTCAGCCTGG + Intronic
1159970555 18:74647398-74647420 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1159988375 18:74872710-74872732 CGGGCCACTCTACTCCAGCCTGG + Intronic
1160061473 18:75532794-75532816 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1160517563 18:79486927-79486949 GCGGGCACTCACCGTCATCCAGG - Exonic
1160763277 19:796393-796415 GCGGCCTCTCACCTACAGCTGGG - Intergenic
1160763315 19:796547-796569 GCGGCCTCTCACCTACAGCTGGG - Intergenic
1161046785 19:2139326-2139348 GGGCCTTCCCACCTTCAGCCAGG + Intronic
1161206702 19:3045168-3045190 AGCGCCACTGAACTTCAGCCTGG + Intronic
1161234453 19:3190925-3190947 AGGGCCACCCACGTTCAGCTGGG - Intronic
1161254942 19:3303127-3303149 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1161435273 19:4259124-4259146 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1161435512 19:4260382-4260404 GGTGCCACTGAACTCCAGCCTGG + Intronic
1161532935 19:4800968-4800990 GGTGCCACCCACATTCGGCCCGG - Exonic
1161579695 19:5074062-5074084 GGAGCCACTGCACTTCAGCCTGG + Intronic
1161607646 19:5223604-5223626 GGGGCTACTGCACTTCAGCCTGG - Intronic
1161654886 19:5508114-5508136 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1161728984 19:5947268-5947290 GGCGCCACTGCTCTTCAGCCTGG + Intronic
1161863473 19:6816918-6816940 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1161878767 19:6932422-6932444 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1161905837 19:7155868-7155890 GGGGCCACTGCACTCCAGCCTGG + Intronic
1161935609 19:7370151-7370173 GGTGCCACTCCACTCCAGCCTGG + Intronic
1161970077 19:7573603-7573625 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1162095611 19:8308137-8308159 GGCGTCACTCACCTGCGGCCTGG + Exonic
1162101033 19:8338829-8338851 GGCGCCACTGCACTTCAGCCTGG + Intronic
1162137079 19:8562076-8562098 TGTGCCACTGCCCTTCAGCCTGG - Intronic
1162152188 19:8654569-8654591 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1162171384 19:8791942-8791964 CGTGCCACTGAACTTCAGCCTGG - Intergenic
1162207713 19:9068459-9068481 CGGGCCACTGCACTTCAGCCTGG - Intergenic
1162229524 19:9254705-9254727 CGGGCCACTGTCCTCCAGCCTGG - Intergenic
1162276123 19:9656463-9656485 GGTGCCACTGCACTTCAGCCTGG + Intronic
1162314525 19:9929993-9930015 CGCGCCACTGACCTCCAGCCTGG + Intronic
1162461018 19:10814122-10814144 GGTGCCACTGAACTCCAGCCTGG + Intronic
1162467964 19:10854104-10854126 TGGGCCACTGCACTTCAGCCTGG - Intronic
1162468185 19:10855570-10855592 GGCGCCACTGAACTCCAGCCTGG - Intronic
1162521601 19:11183692-11183714 GGCTCCACTCCACTTCAGCCTGG - Intronic
1162589396 19:11580867-11580889 TGCACCACTGACCTTCAGCCTGG + Intronic
1162728825 19:12705670-12705692 GAGCCCACTCACCTCCAGCAGGG + Exonic
1162836034 19:13318581-13318603 GGGTTCAGTCACCTCCAGCCTGG - Intronic
1162897721 19:13775321-13775343 GGGGCCACTGCACTCCAGCCTGG - Intronic
1162906943 19:13829779-13829801 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1162943268 19:14027086-14027108 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1163030181 19:14539015-14539037 GGAGCCACTGAACTCCAGCCTGG - Intronic
1163121027 19:15217889-15217911 TGTGCCACTACCCTTCAGCCTGG - Intergenic
1163254512 19:16147438-16147460 GGGGCCACTGCACTCCAGCCTGG + Intronic
1163338907 19:16691567-16691589 TGGGCCACTGCACTTCAGCCTGG + Intergenic
1163413210 19:17169858-17169880 GGCGCCACTACCCTCCAGCCTGG - Intronic
1163507717 19:17718189-17718211 CGCGCCACTACCCTTCAGCCTGG + Intergenic
1163563771 19:18037228-18037250 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1163747135 19:19055229-19055251 AGGCCCGCTCACCTCCAGCCAGG - Intronic
1164009579 19:21188212-21188234 TGGGCCACTGCACTTCAGCCTGG + Exonic
1164319031 19:24122266-24122288 GGTGCCACTGCACTTCAGCCTGG - Intronic
1164549730 19:29199472-29199494 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1164650055 19:29884992-29885014 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1164806035 19:31117644-31117666 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1165216671 19:34279342-34279364 TGGGCCACTGAACTCCAGCCTGG - Intronic
1165233664 19:34403675-34403697 GGCGCCACTGCACTTCAGCCTGG + Intronic
1165244733 19:34492154-34492176 TGGGCCACTGCACTTCAGCCTGG - Intronic
1165245776 19:34497721-34497743 GGGGCCACTCGCCTGCACCCAGG - Intronic
1165309219 19:35020492-35020514 CGGGCCACTGCACTTCAGCCTGG + Intronic
1165321056 19:35085379-35085401 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1165414152 19:35681434-35681456 TGTGCCACTGAACTTCAGCCTGG - Intergenic
1165430982 19:35772573-35772595 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1165484151 19:36085157-36085179 GGTGCCACTCCCCTCTAGCCTGG - Intronic
1165632927 19:37317016-37317038 CGCGCCACTCCCCTCCAGCCTGG - Intronic
1165745478 19:38227999-38228021 GGGGCCCCTCACCCTGACCCTGG - Intronic
1165780486 19:38430843-38430865 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1165805394 19:38577750-38577772 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1165869785 19:38963336-38963358 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1166003302 19:39891166-39891188 CGTGCCACTGCCCTTCAGCCTGG - Intronic
1166015487 19:39976356-39976378 GGCGCCACTGCACTTCAGCCTGG + Intronic
1166079512 19:40434765-40434787 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1166708238 19:44920685-44920707 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1166756702 19:45196855-45196877 GGGGCCACTGCACTCCAGCCTGG + Intronic
1166768653 19:45267100-45267122 GGGGCCACTACACTCCAGCCTGG - Intronic
1166868509 19:45855924-45855946 CGGGCCACTGCCCTCCAGCCTGG + Intronic
1166896795 19:46028169-46028191 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1166930456 19:46298504-46298526 GGGCCCACTCACCATCGCCCAGG - Intronic
1167059700 19:47136363-47136385 AGGGCCAATCACCTGAAGCCAGG - Intronic
1167088509 19:47327185-47327207 GGAGCCACTGCCCTCCAGCCTGG + Intergenic
1167148383 19:47695464-47695486 AGGGCCCCTTACCTGCAGCCCGG - Exonic
1167167197 19:47806474-47806496 GGTGCCACTGAACTCCAGCCTGG + Intronic
1167246937 19:48378960-48378982 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1167317750 19:48775744-48775766 GGTGCCACTGTACTTCAGCCTGG + Intergenic
1167333582 19:48871166-48871188 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1167530658 19:50014222-50014244 GGGGCCACTGCACTCCAGCCTGG + Intronic
1167615516 19:50530778-50530800 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1167626278 19:50591878-50591900 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1167757970 19:51425023-51425045 GGGGCCACTATACTCCAGCCTGG + Intergenic
1167789235 19:51662131-51662153 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1168024831 19:53636320-53636342 GGTGCCACTGAACTCCAGCCTGG + Intronic
1168113061 19:54205858-54205880 GGGGCCACTGCACTCCAGCCTGG - Intronic
1168113677 19:54209127-54209149 GGGGCCCCTCACTTGCAACCAGG + Intronic
1168130552 19:54315990-54316012 GGGGCCACGCACCTGCTCCCTGG - Intergenic
1168179409 19:54650657-54650679 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1168261159 19:55195614-55195636 GGGGCCACTGCACTCCAGCCTGG - Intronic
1168264221 19:55212972-55212994 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1168595311 19:57670901-57670923 GGGGCTACTAAACTTTAGCCTGG - Intronic
1168664616 19:58194420-58194442 GGGGCCACTGCACTTTAGCCTGG - Intronic
1168690111 19:58371362-58371384 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1202706708 1_KI270713v1_random:29757-29779 CGTGCCACTGACCTCCAGCCTGG + Intergenic
925966372 2:9070642-9070664 TGGGCCACTGCACTTCAGCCTGG + Intergenic
926058931 2:9793215-9793237 GGTGCCACTGCGCTTCAGCCTGG + Intergenic
926133717 2:10322064-10322086 GGCGCCACTGCACTTCAGCCTGG - Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926177819 2:10612077-10612099 GGTGCCACTGCCCTCCAGCCTGG + Intronic
926181580 2:10649125-10649147 GGTGGCACTCACCTGCACCCAGG - Intronic
926350687 2:11991506-11991528 GGGGCCACTGCACTCCAGCCTGG - Intergenic
926750900 2:16197700-16197722 GAGGCCACTCATCTCCAGCAGGG - Intergenic
926826390 2:16909455-16909477 GGCGCCACTGCTCTTCAGCCTGG + Intergenic
927189919 2:20510518-20510540 GGGGCCACTGCACTCCAGCCTGG + Intergenic
927200914 2:20577579-20577601 GGTGCCCCTCACCTTGGGCCTGG - Intronic
927636967 2:24823733-24823755 TGTGCCACTCAACTCCAGCCTGG - Intronic
927661247 2:24995053-24995075 GGGGCCACTGCACTACAGCCTGG + Intergenic
927777295 2:25912125-25912147 CGGGCCACTGAACTCCAGCCTGG - Intergenic
927987282 2:27420890-27420912 TGGGCCACTGCACTTCAGCCTGG + Intergenic
928026461 2:27743307-27743329 GGGGCCACTGCACTCCAGCCTGG + Intergenic
928057446 2:28072214-28072236 GGCGCCACTGCCCTCCAGCCTGG - Intronic
928339597 2:30430913-30430935 GGGGCCACTGCACTCCAGCCTGG + Intergenic
928392619 2:30921026-30921048 GGGGCAACTCACACTCATCCTGG - Intronic
928517178 2:32054533-32054555 GGTGCCACTGACCTCCAGCCTGG + Intergenic
928522020 2:32098416-32098438 GGTGCCACTGTACTTCAGCCTGG + Intronic
928639514 2:33283478-33283500 GGCGCCACTCCACTTCAGCCTGG - Intronic
929081990 2:38130173-38130195 GTGGCCACTCACCATCATGCAGG + Intergenic
929142041 2:38675129-38675151 GGGGCCACTGCACTCCAGCCTGG + Intronic
929200137 2:39226808-39226830 GGCGCCACTGCACTTCAGCCTGG - Intronic
929410066 2:41688713-41688735 GGGGCCACTGCACTCCAGCCTGG + Intergenic
929462001 2:42109196-42109218 GGGGCCACTGAACTCCAGCCTGG + Intergenic
929509102 2:42552904-42552926 CGCGCCACTCCCCTCCAGCCTGG + Intronic
929704168 2:44193443-44193465 TGGGCCACTGTACTTCAGCCTGG - Intronic
929822034 2:45281678-45281700 GGGGCCTCTCACCCTAACCCAGG + Intergenic
930643130 2:53874898-53874920 GGGGCCACTGCACTCCAGCCTGG + Intronic
930667372 2:54113281-54113303 GGGGCCACTGCACTCCAGCCTGG - Intronic
930861483 2:56078811-56078833 GAGGCCACTGAACTCCAGCCTGG - Intergenic
931270892 2:60701698-60701720 GGGGCCACTGCACTCCAGCCTGG - Intergenic
931354829 2:61527442-61527464 GGTGCCACTACACTTCAGCCTGG + Intronic
931620847 2:64207959-64207981 GGTGCCACTGCACTTCAGCCTGG - Intergenic
931664168 2:64598469-64598491 TGTGCCACTCAACTCCAGCCTGG - Intergenic
932231268 2:70086511-70086533 GGGGCCGCCCCCCTTGAGCCTGG + Intergenic
932550259 2:72762198-72762220 GGTGCCACTGAACTCCAGCCTGG + Intronic
932610437 2:73195346-73195368 CGGGCCACTCCACTCCAGCCTGG - Intergenic
932743374 2:74309697-74309719 GGCGCCACTACACTTCAGCCTGG - Intronic
932755233 2:74403318-74403340 CGCGCCACTGCCCTTCAGCCTGG + Intergenic
932783585 2:74579849-74579871 GGAGCCACTGCACTTCAGCCTGG - Intronic
933250524 2:80024041-80024063 GGCGCCACTGCACTTCAGCCTGG + Intronic
933364523 2:81333414-81333436 GGTGCCACTGCACTTCAGCCTGG + Intergenic
933470372 2:82715500-82715522 GGTGCCACTGCGCTTCAGCCTGG - Intergenic
933545780 2:83710013-83710035 GGAGCCACTGACCTCCAGTCTGG - Intergenic
933694552 2:85207948-85207970 GGCGCCACTGAACTCCAGCCTGG - Intronic
933787706 2:85857199-85857221 CGGGCCACTGCACTTCAGCCTGG + Intronic
933982003 2:87558127-87558149 TGAGCCACTGAACTTCAGCCTGG - Intergenic
934665386 2:96165705-96165727 GGGGCCACTGCACTCCAGCCTGG + Intergenic
934683444 2:96303176-96303198 GGTGCTACTCAGCTTCATCCAGG - Exonic
934696304 2:96403153-96403175 GGTGCCACTGCACTTCAGCCTGG - Intergenic
934850450 2:97696690-97696712 GGGGCCACTACACTCCAGCCTGG + Intergenic
935067460 2:99662094-99662116 CGCGCCACTGAACTTCAGCCTGG + Intronic
935677230 2:105605872-105605894 CGTGCCACTGACCTCCAGCCTGG + Intergenic
935810912 2:106796272-106796294 CGGGCCACTGAACTCCAGCCTGG - Intergenic
936024570 2:109021477-109021499 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
936311835 2:111392690-111392712 TGAGCCACTGAACTTCAGCCTGG + Intergenic
936679509 2:114753863-114753885 GGCGCCACTGAACTCCAGCCTGG + Intronic
937133218 2:119528951-119528973 GGCACCACTCCACTTCAGCCTGG - Intergenic
938019687 2:127895876-127895898 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
938255240 2:129853566-129853588 GGCGCCACTGCACTTCAGCCTGG + Intergenic
938543059 2:132302314-132302336 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
938931306 2:136088775-136088797 GGCGCCACTGTACTTCAGCCTGG - Intergenic
938933280 2:136105921-136105943 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
938949729 2:136245159-136245181 GGGGCCACTACACTCCAGCCTGG + Intergenic
939811016 2:146832372-146832394 TGGGCCACTGAACTGCAGCCTGG - Intergenic
940260121 2:151770573-151770595 GGTGCCACTGTACTTCAGCCTGG + Intergenic
940304141 2:152207631-152207653 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
940309080 2:152258230-152258252 GGTGCCACTGCACTTCAGCCTGG - Intergenic
940556125 2:155231329-155231351 GGCGCCACTCCACTCCAGCCTGG + Intergenic
940645951 2:156393212-156393234 AGGGCCACTGCACTTCAGCCTGG + Intergenic
940938934 2:159534669-159534691 GGCGCCACTGCCCTCCAGCCTGG - Intronic
941622020 2:167788952-167788974 GGGACCACTGACCCTCTGCCTGG - Intergenic
942218477 2:173746017-173746039 GGCGCCACTGCTCTTCAGCCTGG + Intergenic
942252616 2:174060258-174060280 GGGGCCACTGCACTTCAGCCTGG + Intergenic
942951136 2:181723221-181723243 GGGGCCACTGCACTCCAGCCTGG + Intergenic
942957341 2:181788453-181788475 TGGGCCACTGAACTCCAGCCTGG + Intergenic
943585262 2:189731724-189731746 GGGGTCTCTCACTGTCAGCCAGG + Intronic
943895898 2:193359142-193359164 TGGGCCACTGAACTTCAGCTTGG + Intergenic
945032849 2:205681909-205681931 GGCGACACACACCGTCAGCCCGG - Intergenic
945459842 2:210093187-210093209 CGTGCCACTGCCCTTCAGCCTGG - Intronic
945475792 2:210280902-210280924 CGGGCCACTGAACTCCAGCCTGG - Intergenic
945523029 2:210852810-210852832 GGTGCCACTGCACTTCAGCCTGG + Intergenic
946020776 2:216638459-216638481 GGCGCCACTCCACTCCAGCCTGG + Intronic
946397729 2:219451677-219451699 TGTGCCGCTCACCCTCAGCCCGG - Exonic
946402782 2:219477247-219477269 GTGGGGTCTCACCTTCAGCCTGG - Intronic
946499592 2:220232256-220232278 GGTGCCACTGAACTCCAGCCTGG + Intergenic
946764807 2:223030719-223030741 GGAGCCACTGAACTCCAGCCTGG - Intergenic
946836935 2:223782053-223782075 GGCGCCACTGCCCTCCAGCCTGG - Intronic
946924957 2:224617500-224617522 GGGGCCACTGCACTCCAGCCTGG - Intergenic
946937828 2:224739618-224739640 GGGGCCACTGCACTACAGCCTGG - Intergenic
947404010 2:229755857-229755879 GGTGCCACTGCACTTCAGCCTGG - Intergenic
947495714 2:230634933-230634955 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
947643295 2:231719429-231719451 TGGGCCACTGCACTTCAGCCTGG + Intergenic
947706583 2:232281353-232281375 GGCGCCACTGCACTTCAGCCTGG + Intronic
948049887 2:234972173-234972195 GGCGCCACTGCCCTCCAGCCTGG - Intronic
948112285 2:235465757-235465779 GGAGCCACTGAACTCCAGCCTGG - Intergenic
948267083 2:236642904-236642926 GGGGCCATTCACATTCTTCCTGG + Intergenic
948585720 2:239018441-239018463 GGGGCCTCACACCTGCAGCCGGG - Intergenic
948964904 2:241371438-241371460 GGGGCCAGTGCACTTCAGCCTGG + Intronic
1168756249 20:320210-320232 CGTGCCACTGCCCTTCAGCCTGG + Intergenic
1168817074 20:745261-745283 TGTGCCACTGCCCTTCAGCCTGG + Intergenic
1168862750 20:1057833-1057855 CGAGCCACTGAACTTCAGCCTGG - Intergenic
1168987883 20:2065927-2065949 TGCGCCACTGAACTTCAGCCTGG + Intergenic
1169022964 20:2343363-2343385 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1169109039 20:3020150-3020172 GGCACCACTGCCCTTCAGCCTGG - Intronic
1169141560 20:3229865-3229887 GGGTCCCCTCACCTTCCCCCTGG - Intronic
1169144893 20:3246029-3246051 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1169250275 20:4055255-4055277 GGAGCCACTGCACTTCAGCCTGG + Intergenic
1169279224 20:4252967-4252989 GGCGCCACTCCACTCCAGCCTGG + Intergenic
1169313275 20:4566363-4566385 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1169356419 20:4910331-4910353 TGGGCCACTCCACTTCAGCCTGG + Intronic
1169423591 20:5479074-5479096 GGGGCCACTCCACTCTAGCCTGG - Intergenic
1169595668 20:7195403-7195425 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1169598033 20:7223024-7223046 GGGGCCACTTAACTCCAGCCTGG + Intergenic
1170217238 20:13904482-13904504 GGCGCCACTCTACTCCAGCCTGG + Intronic
1170217443 20:13906720-13906742 GGGGCCACTGCACTCCAGCCTGG - Intronic
1170329641 20:15194200-15194222 TGAGCCACTGAACTTCAGCCTGG + Intronic
1170344846 20:15373446-15373468 GGTGCCACTGCCTTTCAGCCTGG - Intronic
1170385670 20:15813733-15813755 TGGGCCACTGCACTTCAGCCTGG + Intronic
1170465531 20:16619230-16619252 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1170482991 20:16786845-16786867 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1170641019 20:18152531-18152553 GGGGCCACTTCACTCCAGCCTGG + Intronic
1170676629 20:18487905-18487927 TGTGCCACTGACCTCCAGCCTGG + Exonic
1171030555 20:21672658-21672680 TGGGCCACTGCCCTCCAGCCTGG - Intergenic
1171128341 20:22624330-22624352 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1171871937 20:30535143-30535165 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1171965871 20:31529921-31529943 GGTGCCACTGCACTTCAGCCTGG + Intronic
1171983235 20:31641742-31641764 GGGGCCACTGCACTCCAGCCTGG - Intronic
1171987948 20:31673605-31673627 GGGGCCACTGTACTCCAGCCTGG + Intronic
1172473030 20:35214948-35214970 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1172516109 20:35534971-35534993 GGGGCCACTGTACTCCAGCCTGG - Intergenic
1172672545 20:36644313-36644335 GAGGCCACACAGCTCCAGCCAGG - Intronic
1172864142 20:38082428-38082450 GGCGCCACTCTACTCCAGCCTGG - Intronic
1172880842 20:38199089-38199111 GGGGCCTCTCACCATGAGCATGG - Intergenic
1172994795 20:39062540-39062562 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1173235343 20:41240038-41240060 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1173648804 20:44650469-44650491 GGTGCCACTGCACTTCAGCCTGG - Intronic
1174009722 20:47439808-47439830 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1174219186 20:48939016-48939038 GGTGCCACTGCACTTCAGCCTGG - Intronic
1174440041 20:50544192-50544214 TGGGCCACTGTACTTCAGCCTGG - Intronic
1174474629 20:50787687-50787709 AGGGCCACTGCCCTCCAGCCTGG + Intergenic
1174636158 20:52001399-52001421 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1174656275 20:52175164-52175186 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1174799326 20:53550014-53550036 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1174949217 20:55026224-55026246 GGGGCATCTCAGCTCCAGCCTGG - Intergenic
1175276284 20:57773137-57773159 TGTGCCACTGACCATCAGCCTGG + Intergenic
1175445184 20:59015124-59015146 GGGGGCCGTCACCTTCAGCCTGG + Intergenic
1175589244 20:60174262-60174284 GGTGCCACTATCCTCCAGCCTGG + Intergenic
1175652588 20:60738685-60738707 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1175774549 20:61644774-61644796 GGGGCAGCCCACCGTCAGCCAGG + Intronic
1175877769 20:62238587-62238609 GGGGCCACTCACCTGGACGCGGG - Exonic
1175937663 20:62521878-62521900 GGTGCCACTGCCCTTCAGCCTGG - Intergenic
1176071413 20:63228559-63228581 TGGGCCACTGAACTCCAGCCAGG - Intergenic
1176421755 21:6521704-6521726 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1177148882 21:17434862-17434884 GGAGCCACTGCCCTCCAGCCTGG + Intergenic
1177157042 21:17510922-17510944 GGGGTCACTGAACTCCAGCCTGG + Intergenic
1177258722 21:18700557-18700579 TGAGCCAATCACCTTCAACCAGG - Intergenic
1177702467 21:24656315-24656337 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1177838241 21:26209519-26209541 GGGGCCACTGAACTCCAGCCTGG - Intergenic
1177973146 21:27815288-27815310 GGGGCCACTGCTCTTCAGCCTGG - Intergenic
1178030430 21:28520019-28520041 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1178724699 21:35040725-35040747 GGGGCCACTGCACTCCAGCCTGG + Intronic
1179208025 21:39302024-39302046 GGGGCCACTACACTCCAGCCTGG - Intronic
1179312836 21:40212011-40212033 TGGGCCACTGAACTCCAGCCTGG - Intronic
1179370965 21:40805750-40805772 GGGGCCACTGCACTCCAGCCTGG - Intronic
1179637066 21:42719594-42719616 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1179697245 21:43130020-43130042 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1179940340 21:44635300-44635322 GGGGCCACTGCACTCCAGCCTGG + Intronic
1179963269 21:44784110-44784132 CAGGCCACTGAACTTCAGCCTGG + Intronic
1180217594 21:46335550-46335572 GGTGCCACTGCACTTCAGCCTGG + Intronic
1180543708 22:16478388-16478410 GGCGCCACTTCCCTCCAGCCTGG + Intergenic
1180566562 22:16672466-16672488 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1180578100 22:16799368-16799390 CGGGCCACTGAACTCCAGCCTGG + Intronic
1180690416 22:17710024-17710046 TGCGCCACTGACCTCCAGCCTGG + Intronic
1180829721 22:18898307-18898329 GGCGCCACTCTGCTACAGCCTGG - Intergenic
1180881221 22:19204808-19204830 GGGGCCAGTAACCTTCAGCCTGG - Intronic
1181117665 22:20643350-20643372 CGCGCCACTGCCCTTCAGCCTGG - Intergenic
1181369099 22:22402486-22402508 TGCGCCACTGAACTTCAGCCTGG - Intergenic
1181550407 22:23635582-23635604 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1181566152 22:23739640-23739662 TGTGCCACTACCCTTCAGCCTGG - Intergenic
1181625700 22:24120767-24120789 TGGGCCACTGCACTTCAGCCTGG + Intronic
1181842026 22:25671294-25671316 GGCGCCACTGCACTTCAGCCTGG + Intronic
1181848291 22:25730802-25730824 TGGGCCACTGCACTTCAGCCTGG + Intergenic
1182213590 22:28697611-28697633 GGTGCCACTGCACTTCAGCCTGG - Intronic
1182233910 22:28860683-28860705 CGGGCCACTGCCCTCCAGCCCGG - Intergenic
1182250884 22:28999288-28999310 GGTGCCACTGCACTTCAGCCTGG + Intronic
1182312662 22:29420372-29420394 GGGGCCACTGCACTCCAGCCTGG - Intronic
1182417466 22:30230563-30230585 GGTGCCACTACACTTCAGCCTGG + Intergenic
1182728488 22:32468205-32468227 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1182864452 22:33591155-33591177 GGGGCCACTGCACTCCAGCCTGG + Intronic
1182946802 22:34331850-34331872 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1183351649 22:37337909-37337931 TGTGCCACTGCCCTTCAGCCTGG - Intergenic
1183503493 22:38195431-38195453 CGGGCCACTGCCCTCCAGCCTGG + Intronic
1183529159 22:38343329-38343351 GGCGCCACTGCACTTCAGCCTGG + Intronic
1183763901 22:39852301-39852323 GGTGCCACTGTACTTCAGCCTGG + Intronic
1183798750 22:40143531-40143553 TGGGCCACTGCACTTCAGCCTGG - Intronic
1183894852 22:40960070-40960092 TGTGCCACTGCCCTTCAGCCTGG + Intronic
1184107304 22:42375610-42375632 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1184140048 22:42573285-42573307 CGGGCCACTGCCCTCCAGCCTGG - Intronic
1184276742 22:43413000-43413022 TGGGCCACCCAGCTTGAGCCCGG - Intronic
1184461028 22:44638139-44638161 GGTGCCACTGACCTCTAGCCTGG + Intergenic
1184484527 22:44768341-44768363 TGCGCCACTGCCCTTCAGCCTGG - Intronic
1184953873 22:47867059-47867081 AGAGCCACTCCACTTCAGCCTGG - Intergenic
1184959953 22:47921617-47921639 GGGGCCTCTGCCCTCCAGCCCGG + Intergenic
1203279812 22_KI270734v1_random:123580-123602 GGCGCCACTCTGCTACAGCCTGG - Intergenic
949103253 3:171797-171819 CGGGCCACTGCCCTCCAGCCTGG - Intergenic
949150083 3:756530-756552 TGGGCCACTGAACTCCAGCCTGG - Intergenic
949263123 3:2125600-2125622 GGTGCCACTGAACTCCAGCCTGG - Intronic
949364823 3:3269435-3269457 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
949494373 3:4617939-4617961 GGTGCCACTGAACTCCAGCCTGG + Intronic
949630532 3:5920726-5920748 GGAGCCACTGCCCTCCAGCCTGG + Intergenic
950204992 3:11072625-11072647 GGCGCCACTGCACTTCAGCCTGG - Intergenic
950244087 3:11399302-11399324 GGTGCCACTCTACTCCAGCCTGG + Intronic
950351606 3:12359716-12359738 GGCGCCACTGCACTTCAGCCTGG - Intronic
950379215 3:12596940-12596962 CGTGCCACTCCACTTCAGCCTGG - Intronic
950513090 3:13445169-13445191 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
950531599 3:13555496-13555518 GGCGCCACTGCACTTCAGCCTGG - Intronic
950626596 3:14251953-14251975 TGGGCCACTCCACTCCAGCCTGG + Intergenic
950821294 3:15762142-15762164 GGTGCCACTGCCCTCCAGCCTGG + Intronic
951735254 3:25856419-25856441 CGTGCCACTCAACTCCAGCCTGG + Intergenic
952278632 3:31902304-31902326 GGTGCCACTGCGCTTCAGCCTGG - Intronic
952903425 3:38124561-38124583 GGAGCCACTCCACTCCAGCCTGG + Intronic
953497492 3:43400734-43400756 GGTGCCACTGAACTCCAGCCTGG + Intronic
953713594 3:45296259-45296281 GGTGCCACTCCACTCCAGCCTGG - Intergenic
953945748 3:47145970-47145992 GGTGCCACTGCACTTCAGCCTGG + Intronic
954086213 3:48245901-48245923 CGTGCCATTGACCTTCAGCCTGG + Intronic
954250900 3:49366557-49366579 TGTGCCACTCAACTCCAGCCTGG + Intronic
954264931 3:49464541-49464563 GGAGCCACTGAACTCCAGCCTGG + Intergenic
954400238 3:50315725-50315747 TGGGCCACTGAACTCCAGCCTGG - Intergenic
954736389 3:52710319-52710341 TGGGCCACTGCACTTCAGCCTGG + Exonic
954788422 3:53112697-53112719 GGCACCACTGAACTTCAGCCTGG + Intronic
955197621 3:56819851-56819873 TGTGCCACTGACCTCCAGCCTGG - Intronic
955214247 3:56971808-56971830 GGTGCCACTGAACTCCAGCCTGG + Intronic
955315937 3:57939170-57939192 GGTGCCACTGAACTCCAGCCTGG + Intergenic
955520117 3:59767522-59767544 AGGGCATCTCTCCTTCAGCCAGG - Intronic
955617961 3:60828832-60828854 GGTGCCACTGAACTCCAGCCTGG + Intronic
955893101 3:63670996-63671018 TGCGCCACTGAACTTCAGCCTGG + Intronic
956138350 3:66120761-66120783 TGGGCCACTGCCCTCCAGCCTGG + Intergenic
956226855 3:66970171-66970193 GGGGCCACTGCACTCCAGCCTGG - Intergenic
956545537 3:70397346-70397368 GGTGCCACTGCACTTCAGCCTGG - Intergenic
957521695 3:81326644-81326666 GGGGCCACTGCACTCCAGCCTGG + Intergenic
957924607 3:86792255-86792277 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
958007484 3:87831404-87831426 GGCGCCACTGCACTTCAGCCTGG - Intergenic
958195078 3:90234150-90234172 GGAGCCACTCCACTCCAGCCTGG + Intergenic
958979234 3:100701745-100701767 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
959344944 3:105182237-105182259 GGCGCCACTGCCCTGCAGCCTGG - Intergenic
959568085 3:107853165-107853187 GGGGCCACTGCACTCCAGCCTGG - Intergenic
959691871 3:109206353-109206375 GGTGCCACTGCACTTCAGCCTGG + Intergenic
959974197 3:112439404-112439426 GGCGCCACTCTACTCCAGCCTGG + Intergenic
960211764 3:114976580-114976602 CGCGCCACTGCCCTTCAGCCTGG + Intronic
960298539 3:115973688-115973710 GGTGCCACTGCACTTCAGCCTGG + Intronic
960317727 3:116198725-116198747 GGCGCCACTGCACTTCAGCCTGG + Intronic
960629666 3:119717144-119717166 CTGGCCCCTCACCTTCAGGCAGG - Intronic
961190414 3:124956534-124956556 GGCGCCACTGCACTTCAGCCTGG - Intergenic
961720140 3:128888533-128888555 GGCGCCACTGCACTTCAGCCTGG + Intronic
961842434 3:129726823-129726845 GGTGCCACTGCACTTCAGCCTGG + Intronic
961961668 3:130862015-130862037 GGCGCCACTGCACTTCAGCCTGG - Intronic
962260334 3:133898031-133898053 GGGGCCACTGAACCTCAGCCTGG + Intergenic
962516582 3:136157456-136157478 AGTGCCACTCAACTCCAGCCTGG + Intronic
962546340 3:136440179-136440201 TGCGCCACTGCCCTTCAGCCTGG - Intronic
962789922 3:138801997-138802019 GGTGCCACTGAACTCCAGCCTGG + Intronic
962857468 3:139360913-139360935 GGTGGCACTCACCTTCAGCAAGG - Intronic
963072389 3:141315150-141315172 TGTGCCACTGAACTTCAGCCTGG + Intergenic
963218589 3:142779889-142779911 GGTGCCACTGCCCTCCAGCCTGG - Intronic
964141496 3:153406202-153406224 GGTGCCACTGCACTTCAGCCTGG + Intergenic
964169978 3:153758494-153758516 GGCGCCACTGAACTTCAGCCTGG - Intergenic
964774175 3:160256810-160256832 GGGGCCACTGCACTCCAGCCTGG + Intronic
964968011 3:162522174-162522196 TGATCCAATCACCTTCAGCCAGG + Intergenic
965208143 3:165748886-165748908 GGGGCCACTGCACTCCAGCCTGG - Intergenic
965218179 3:165892161-165892183 AGTGCCACTGACCTCCAGCCTGG + Intergenic
965390911 3:168102369-168102391 GGTGCCACTGCTCTTCAGCCTGG + Intergenic
965687926 3:171325055-171325077 GGCGCCACTGCACTTCAGCCTGG + Intronic
965881380 3:173392427-173392449 CGGGCCACTGCACTTCAGCCTGG + Intergenic
965926411 3:173985904-173985926 GGTGCCACTGAACTCCAGCCTGG + Intronic
966171172 3:177082797-177082819 GGTGCCACTGCCCGTCAGCCTGG - Intronic
966209058 3:177433996-177434018 GGTGCCACTGCACTTCAGCCTGG + Intergenic
966437728 3:179907354-179907376 TGCGCCACTGAACTTCAGCCTGG - Intronic
966894280 3:184430874-184430896 GGGGCCACTGCACTCCAGCCTGG + Intronic
967010597 3:185429572-185429594 GGTGCCACTGCACTTCAGCCTGG + Intronic
967179595 3:186892237-186892259 TGTGCCACTGCCCTTCAGCCTGG + Intergenic
967551950 3:190806764-190806786 GGTGCCACTGCACTTCAGCCTGG - Intergenic
967595001 3:191317620-191317642 GGTGCCACTGCACTTCAGCCTGG - Intronic
967792371 3:193562825-193562847 GGTGCCACTGAACTCCAGCCTGG + Intronic
967926175 3:194649961-194649983 GGTGCCACTGCCCTCCAGCCTGG - Intronic
968569063 4:1329855-1329877 GGGCCCTCTCACCTGCTGCCAGG + Intronic
968618900 4:1594797-1594819 GGTGCCACTGCACTTCAGCCTGG + Intergenic
968806598 4:2777126-2777148 GGGGCCACTGCACTCCAGCCTGG - Intergenic
968854008 4:3104858-3104880 TGTGCCACTGCCCTTCAGCCTGG + Intronic
968967351 4:3775796-3775818 GGAGCCCCTCCCCTCCAGCCAGG - Intergenic
968978905 4:3836294-3836316 AGGGCCACTCACCCTCGTCCAGG + Intergenic
969083047 4:4634645-4634667 GGCGCCACTGTACTTCAGCCTGG + Intergenic
969385496 4:6843981-6844003 GGCGCCACTGCACTTCAGCCTGG - Intronic
969396197 4:6923156-6923178 GGCGCCACTGCCCTCCAGCCTGG + Intronic
969411243 4:7029779-7029801 GGCGCCACTCCACTCCAGCCTGG + Intronic
969547402 4:7840355-7840377 CGTGCCACTGAACTTCAGCCTGG - Intronic
969677842 4:8624536-8624558 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
969678797 4:8630177-8630199 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
969679753 4:8635819-8635841 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
970112138 4:12650708-12650730 GGTGCCACTACCCTCCAGCCTGG - Intergenic
970118176 4:12722574-12722596 GGTGCCACTGCACTTCAGCCTGG + Intergenic
970600984 4:17640975-17640997 CGGGCCACTGCACTTCAGCCTGG - Intronic
970918909 4:21369863-21369885 GGTGCCACTGAACTCCAGCCTGG - Intronic
970947738 4:21715122-21715144 GGGGCCACTGCACTCCAGCCTGG - Intronic
971404393 4:26308230-26308252 CGGGCCACTGCCCTCCAGCCTGG + Intronic
972303665 4:37811072-37811094 CGGGCCACTGCGCTTCAGCCTGG - Intergenic
972434306 4:39017216-39017238 GGTGCCACTGAACTCCAGCCTGG - Intronic
972474144 4:39434848-39434870 GGTGCCACTGCACTTCAGCCTGG - Intronic
972506492 4:39724724-39724746 GGCGCCACTGCCCTTCAGCCTGG + Intronic
972530999 4:39961340-39961362 GGCGCCACTACCCTTCAGCCTGG - Intronic
972657025 4:41074080-41074102 GGTGCCACTGCACTTCAGCCTGG + Intronic
972690919 4:41396854-41396876 GGTGCCACTGCGCTTCAGCCTGG + Intronic
972875554 4:43354353-43354375 TGTGCCACTAAACTTCAGCCTGG + Intergenic
972954280 4:44369702-44369724 TGGGAGAGTCACCTTCAGCCAGG + Intronic
973598038 4:52512741-52512763 GGCGCCACTTCACTTCAGCCTGG - Intergenic
973894514 4:55397788-55397810 GGGGCCACTGCACTCCAGCCTGG - Intronic
974402038 4:61420448-61420470 GGCGCCACTGCACTTCAGCCTGG - Intronic
974811801 4:66955642-66955664 GGAGCCACTGAACTGCAGCCTGG - Intergenic
974847346 4:67367030-67367052 GGTGCCACTACCCTCCAGCCTGG + Intergenic
974898124 4:67964344-67964366 GGGGCCACTGCACTCCAGCCTGG - Intergenic
974941830 4:68478496-68478518 CGGGCCACTGAACTCCAGCCTGG - Intronic
975262602 4:72321213-72321235 GGTGCCACTGCACTTCAGCCTGG - Intronic
975583173 4:75925033-75925055 GGTGCCACTGAACTCCAGCCTGG - Intronic
975739240 4:77412737-77412759 CGGGCCACTCCACTCCAGCCTGG + Intronic
975862974 4:78697505-78697527 TGTGCCACTCCCCTCCAGCCTGG - Intergenic
975988970 4:80236880-80236902 GGTGCCACTGAACTCCAGCCTGG + Intergenic
976181937 4:82407292-82407314 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
976273870 4:83256605-83256627 GGCGCCACTGAACTCCAGCCGGG - Intergenic
976283775 4:83351049-83351071 CATGCCACTGACCTTCAGCCTGG - Intergenic
976415639 4:84771178-84771200 TGTGCCACTGACCTTCAACCTGG - Intronic
976428644 4:84936475-84936497 CGTGCCACTGCCCTTCAGCCTGG + Intronic
976646217 4:87390197-87390219 GGCGCCACTGCACTTCAGCCTGG - Intronic
976760926 4:88548702-88548724 GGTGCCACTGCCCTCCAGCCTGG - Intronic
977153848 4:93548131-93548153 GGTGCCACTGCCCTTCAGCCTGG + Intronic
977748055 4:100575288-100575310 TGTGCCACTGAACTTCAGCCTGG - Intronic
979081546 4:116349807-116349829 GGCGCCACTGCACTTCAGCCTGG + Intergenic
979403067 4:120274623-120274645 GGTGCCACTCTACTTCAACCTGG + Intergenic
979786131 4:124717683-124717705 TGTGCCACTAAACTTCAGCCTGG - Intergenic
980129621 4:128806209-128806231 GGGACCACTGAACTCCAGCCTGG + Intergenic
980153961 4:129081651-129081673 TGATCCACTCACCTTCAACCAGG + Intronic
980624570 4:135357754-135357776 GGCGCCACTGAACTCCAGCCTGG - Intergenic
980999022 4:139810234-139810256 GGGGCCACTGCACTCCAGCCTGG - Intronic
981029837 4:140113233-140113255 AGGGCCACTGAACTCCAGCCTGG + Intronic
981086357 4:140688623-140688645 GGTGCCACTGCACTTCAGCCTGG + Intronic
981727144 4:147860396-147860418 GGGGCCACTGCACTCCAGCCTGG + Intronic
981729948 4:147886812-147886834 GGTGCCACTGCCCTCCAGCCTGG - Intronic
981755002 4:148133147-148133169 AGGGCCACTGCACTTCAGCCTGG + Intronic
981769074 4:148285661-148285683 TGTGCCACTGACCTCCAGCCTGG + Intronic
982342231 4:154312503-154312525 TGGGCCACTGCCCTCCAGCCTGG + Intronic
982491045 4:156030142-156030164 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
982784984 4:159526173-159526195 GGTGCCACTGTACTTCAGCCTGG + Intergenic
983257929 4:165422931-165422953 GGTGCCACTGCCCTCCAGCCTGG + Intronic
983265362 4:165502221-165502243 GGGGCCACTGAAATTTAGCCTGG - Intergenic
983753702 4:171307195-171307217 GGTGCCACTGAACTCCAGCCTGG + Intergenic
983891253 4:173032639-173032661 GGCGCCACTGTGCTTCAGCCTGG + Intronic
983903568 4:173162296-173162318 GGGGCCACTGCACTCCAGCCTGG + Intergenic
983992016 4:174130845-174130867 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
984373373 4:178894851-178894873 GGGACCACCCACCTTCATTCAGG - Intergenic
984940324 4:184925726-184925748 TGGGCCACTAAACTCCAGCCTGG + Intergenic
985026760 4:185746358-185746380 GGTGCCACTGCCCTGCAGCCTGG - Intronic
985126058 4:186695833-186695855 TGTGCCACTGCCCTTCAGCCTGG - Intronic
985244574 4:187967335-187967357 GGCGCCACTGAACTCCAGCCTGG - Intergenic
985472411 5:54044-54066 CGGGACACTCACCTGCTGCCCGG + Intergenic
985773792 5:1829543-1829565 GGGGCCACTGCACTCCAGCCTGG - Intergenic
986002636 5:3642344-3642366 GTGGCCACTCACCTCTAGCCTGG - Intergenic
986036392 5:3944488-3944510 GGGGCCACTGCACTCCAGCCTGG - Intergenic
986248830 5:6036938-6036960 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
987198981 5:15555517-15555539 AGGGACATACACCTTCAGCCAGG - Intronic
987314686 5:16713349-16713371 GGGGCATCTCACCTTCAGTTTGG + Intronic
987392521 5:17389295-17389317 GGTGCCACTCCACTCCAGCCTGG - Intergenic
987813554 5:22871393-22871415 GGGGCCACTGCACTCCAGCCTGG - Intergenic
988207390 5:28157639-28157661 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
988432414 5:31134578-31134600 GGGGCCACTGCACTCCAGCCTGG + Intergenic
988521456 5:31949052-31949074 GGAGCCACTGCCCTTCTGCCTGG + Intronic
988925759 5:35990046-35990068 GGCGCCACTGCACTTCAGCCTGG + Intronic
989025972 5:37068934-37068956 GGGGCCACTGCACTCCAGCCTGG - Intergenic
989160790 5:38388714-38388736 TGGGCCACTACCCTCCAGCCTGG + Intronic
989255856 5:39364980-39365002 GGGGCCACTGAACTCCAGCCTGG + Intronic
989303218 5:39918835-39918857 GGTGCCACTGCACTTCAGCCTGG + Intergenic
989726221 5:44589488-44589510 GGGGCCACTGCACTCCAGCCTGG + Intergenic
989963082 5:50439353-50439375 GGTGCCACTAAGCTCCAGCCTGG - Intronic
990081601 5:51922613-51922635 CAGGCCACTCCACTTCAGCCAGG - Intergenic
990247392 5:53876359-53876381 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
990361888 5:55029189-55029211 GGCGCCACTGAACTCCAGCCTGG + Intronic
990401803 5:55445586-55445608 TGGGCCACTGAACTCCAGCCTGG - Intronic
990915141 5:60895124-60895146 GGCGCCACTGCCCTCCAGCCTGG + Intronic
990978473 5:61579860-61579882 GGTGCCACTGCACTTCAGCCTGG + Intergenic
991118332 5:62980694-62980716 GGTGCCACTCTACTCCAGCCTGG - Intergenic
991681211 5:69141691-69141713 TGGGCCACTGCACTTCAGCCTGG + Intergenic
992053482 5:72963584-72963606 GGGGCCACTGCACTCCAGCCTGG - Intronic
992221214 5:74575474-74575496 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
992434104 5:76738802-76738824 GGTGCCACTACACTTCAGCCTGG + Intergenic
992739116 5:79755328-79755350 GGTGCCACTGCACTTCAGCCTGG - Intronic
992777293 5:80099530-80099552 CGCGCCACTCTACTTCAGCCTGG + Intergenic
992781777 5:80134440-80134462 GGGGCCACTGCACTCCAGCCTGG + Intronic
993545093 5:89202185-89202207 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
994058027 5:95441523-95441545 CGTGCCACTCTCCTCCAGCCTGG + Intronic
994293621 5:98061873-98061895 GGTGCCACTACCCTCCAGCCTGG + Intergenic
994498515 5:100543631-100543653 TGTGCCACTCCCCTCCAGCCTGG - Intronic
994649387 5:102507380-102507402 GGGGCCACTTCACTCCAGCCTGG - Intergenic
994759272 5:103833282-103833304 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
994822524 5:104671940-104671962 GGGGCCACTGCACTGCAGCCTGG + Intergenic
994952283 5:106479892-106479914 CGGGCCACTGAACTCCAGCCTGG - Intergenic
995013186 5:107280578-107280600 GGTGCCACTGCACTTCAGCCTGG + Intergenic
995198836 5:109404025-109404047 GGTGCCACTGCCCTCCAGCCTGG + Intronic
995420786 5:111964409-111964431 GGTGCCACTGAACTCCAGCCTGG - Intronic
995439424 5:112173685-112173707 GGGGCCACTGCACTCCAGCCTGG - Intronic
995482850 5:112610083-112610105 GGTGCCACTGCACTTCAGCCTGG - Intergenic
995791802 5:115896734-115896756 TGTGCCACTGAACTTCAGCCTGG + Intronic
996064415 5:119065812-119065834 GGTGCCACTCCACTCCAGCCTGG + Intronic
996077681 5:119216052-119216074 TGGGCCACTGCCCTCCAGCCTGG + Intronic
996208955 5:120781004-120781026 CGCGCCACTGCCCTTCAGCCTGG + Intergenic
997005368 5:129810542-129810564 CGGGCCACTGCACTTCAGCCTGG + Intergenic
997334759 5:133099171-133099193 GGGGCCACTGCACTCCAGCCTGG - Intronic
997454947 5:134009723-134009745 GGTGCCACTGAACTCCAGCCTGG - Intergenic
997493192 5:134296994-134297016 GGGGCCACTGCACTCCAGCCTGG - Intronic
997501484 5:134378124-134378146 GGAGCCACTGAGCTCCAGCCTGG + Intronic
998080409 5:139270652-139270674 GGAGCCACTGCACTTCAGCCTGG - Intronic
998086794 5:139332943-139332965 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
998107828 5:139479656-139479678 TGTGCCACTCTACTTCAGCCCGG + Intronic
998443119 5:142178726-142178748 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
998542657 5:142997450-142997472 GGAGCCACTGCCCTCCAGCCTGG - Intronic
999159671 5:149484995-149485017 GGTGCCACTGAACTCCAGCCTGG - Intergenic
999251707 5:150186332-150186354 GTGGCCACTGACCTCCTGCCGGG - Intergenic
999330714 5:150671898-150671920 GAGGCCACTCACCTGGCGCCAGG - Exonic
1000093039 5:157946816-157946838 GGTGCCACTAAACTCCAGCCTGG - Intergenic
1000191789 5:158918052-158918074 GGCCTCACTCTCCTTCAGCCAGG + Intronic
1000451793 5:161398731-161398753 CGCGCCACTGAACTTCAGCCTGG - Intronic
1000475295 5:161699596-161699618 GTGGCCACTGCACTTCAGCCTGG - Intronic
1000940656 5:167356142-167356164 GGGGCCACTGCACTCCAGCCTGG + Intronic
1001004057 5:168034295-168034317 GGCGCCACTCCACTCCAGCCTGG + Intronic
1001538835 5:172522801-172522823 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1001602393 5:172937624-172937646 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1001800324 5:174537972-174537994 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1001914284 5:175546849-175546871 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1002076291 5:176710457-176710479 GGGGCCAGTGAGCTGCAGCCTGG - Intergenic
1002285047 5:178156751-178156773 GGGGCCACTATACTCCAGCCTGG - Intergenic
1002542923 5:179917960-179917982 TGCGCCACTGCCCTTCAGCCTGG + Intronic
1002608230 5:180396327-180396349 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1002714930 5:181221095-181221117 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1002791649 6:441634-441656 GAGGCCACTCTCCTTGAGGCTGG - Intergenic
1003207796 6:4029385-4029407 GGGGCCACTGCACTCCAGCCTGG - Intronic
1003282830 6:4709237-4709259 GGGGCCACTGCACTCCAGCCTGG - Intronic
1003392500 6:5725889-5725911 GGGGCCACTGCACTCCAGCCTGG + Intronic
1003554937 6:7130980-7131002 CGCGCCACTGACCTCCAGCCTGG - Intronic
1003576706 6:7303281-7303303 GGGGCCACTGCTCTCCAGCCTGG + Intronic
1003592713 6:7449136-7449158 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1003774019 6:9339474-9339496 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1003888575 6:10543245-10543267 GGAGCCACCGAACTTCAGCCTGG - Intronic
1004380286 6:15126878-15126900 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1004388798 6:15192154-15192176 TGTGCCACTGCCCTTCAGCCTGG - Intergenic
1004401533 6:15293369-15293391 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1004405850 6:15332973-15332995 GGGGCCACTGCACTCCAGCCTGG - Intronic
1004489742 6:16103348-16103370 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1004505087 6:16240590-16240612 GGTGCCACTGCACTTCAGCCTGG + Intronic
1004641263 6:17517855-17517877 CGTGCCACTGCCCTTCAGCCTGG + Intronic
1004816344 6:19315506-19315528 GGTGCCACTCCACTCCAGCCTGG + Intergenic
1004933580 6:20485533-20485555 TGGGCCACTGAACTCCAGCCTGG + Intronic
1004980288 6:21015902-21015924 TGTGCCACTGAACTTCAGCCTGG + Intronic
1005091582 6:22062245-22062267 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1005435229 6:25802988-25803010 GGGGCCACTGCACTCCAGCCTGG - Intronic
1005447641 6:25941012-25941034 TGGGCCACTGAGCTACAGCCTGG + Intergenic
1005465050 6:26104729-26104751 CGCGCCACTCCCCTCCAGCCTGG + Intergenic
1005627152 6:27673332-27673354 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1005633673 6:27732975-27732997 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1005729065 6:28678070-28678092 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1005736678 6:28754416-28754438 GAGGCCACTGCCCTCCAGCCTGG - Intergenic
1005762943 6:28984726-28984748 GGCGCCACTCCACTCCAGCCTGG - Intergenic
1005790133 6:29291332-29291354 GATGCCACTCACCCTCATCCTGG + Intergenic
1006018868 6:31104792-31104814 GGTGCCACTCCACTTCAGCCTGG + Intergenic
1006085749 6:31593711-31593733 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1006307622 6:33233831-33233853 TGCGCCACTGACCTCCAGCCTGG + Intergenic
1006478212 6:34271825-34271847 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1006491235 6:34390248-34390270 GGGGCCACTGCACTCCAGCCTGG + Intronic
1006563477 6:34934189-34934211 TGGGCCACTGCACTTCAGCCTGG - Intronic
1006607218 6:35266842-35266864 GGCGCCACTGCACTTCAGCCTGG - Intronic
1006611672 6:35297942-35297964 GGTGCCCCTCACCTTGAGCTGGG - Exonic
1006766524 6:36511398-36511420 GGCGCCACTGCACTTCAGCCTGG - Intronic
1006838946 6:37015850-37015872 GGGGCCTCTTACCTTCATCCCGG - Exonic
1006865712 6:37207549-37207571 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1006926176 6:37656414-37656436 TGCGCCATTCCCCTTCAGCCTGG - Intronic
1007041195 6:38724031-38724053 GGTGCCACTCCACTCCAGCCTGG - Intronic
1007449728 6:41933582-41933604 GGGGCCACTACACTCCAGCCTGG + Intergenic
1007477373 6:42127966-42127988 GGCGCCACTGCCCTCCAGCCTGG - Intronic
1007559404 6:42793810-42793832 GGGGCCACTGTACTCCAGCCCGG - Intronic
1007676376 6:43599030-43599052 TGGGCCACTGAACTCCAGCCTGG - Intronic
1008329878 6:50232213-50232235 TGGGCCACTCAACTCCAGTCTGG - Intergenic
1008385626 6:50886602-50886624 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1008717961 6:54312098-54312120 GGCGCCACTGTACTTCAGCCTGG - Intronic
1008739846 6:54593838-54593860 TGCGCCACTGAACTTCAGCCTGG - Intergenic
1008831192 6:55764526-55764548 GGTGCCACTTCACTTCAGCCTGG + Intronic
1009060211 6:58388997-58389019 TGGGCCACTAAACTCCAGCCTGG + Intergenic
1009190495 6:60623474-60623496 GGTGCCACTTCCCTCCAGCCTGG + Intergenic
1009411802 6:63373889-63373911 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1009919494 6:70039804-70039826 GGGGCTACTGCACTTCAGCCTGG - Intronic
1009966272 6:70582113-70582135 GGCGCCACTGCACTTCAGCCTGG - Intronic
1010042420 6:71401590-71401612 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1010148534 6:72701621-72701643 GGTGCCACTGCACTTCAGCCTGG - Intronic
1010279295 6:74005298-74005320 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1010502852 6:76622727-76622749 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1010626915 6:78148327-78148349 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1010742113 6:79519671-79519693 GGCGCCACTGAACTCCAGCCTGG + Intronic
1010770038 6:79817478-79817500 GGGGCCGCTGCCCTCCAGCCTGG + Intergenic
1011378930 6:86721379-86721401 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1011473796 6:87733351-87733373 TGTGCCACTGAACTTCAGCCTGG + Intergenic
1011487180 6:87854919-87854941 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1012291371 6:97459545-97459567 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1012324659 6:97901220-97901242 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
1012558182 6:100542636-100542658 GGCGCCACTGCACTTCAGCCTGG + Intronic
1012687746 6:102273680-102273702 GGTGCCACTGACCTCCAGCCTGG + Intergenic
1012833716 6:104239160-104239182 TGAGCCACTGTCCTTCAGCCTGG - Intergenic
1013053467 6:106560048-106560070 CGTGCCACTGCCCTTCAGCCTGG + Intronic
1013442673 6:110187020-110187042 TGCGCCACTCAACTCCAGCCTGG - Intronic
1013692217 6:112659437-112659459 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1014126507 6:117782496-117782518 GGGGCCACTGCACTCCAGCCAGG - Intergenic
1014207467 6:118671891-118671913 GGTGCCACTGAACTCCAGCCTGG + Intronic
1014748607 6:125230041-125230063 GGCGCCACTCCACTCCAGCCTGG + Intronic
1014772652 6:125474708-125474730 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1014827398 6:126061924-126061946 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1014978744 6:127921540-127921562 CGCGCCACTGCCCTTCAGCCTGG - Intergenic
1014994378 6:128124085-128124107 GTTGCCACTGAACTTCAGCCTGG - Intronic
1015241965 6:131034486-131034508 GGCGCCACTCCACTCCAGCCTGG + Intronic
1015364784 6:132385525-132385547 TGTGCCACTGAACTTCAGCCTGG - Intronic
1015464567 6:133534385-133534407 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1015492200 6:133838667-133838689 CGCGCCACTGAACTTCAGCCTGG - Intergenic
1015519800 6:134118772-134118794 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1015774879 6:136804162-136804184 GGGGCCACTGTACTCCAGCCTGG - Intergenic
1016131800 6:140481998-140482020 GGCGCCACTACACTTCAGCCTGG + Intergenic
1016136899 6:140555159-140555181 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1016172034 6:141029847-141029869 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1016370078 6:143364614-143364636 GGTGCCACTGACCTCCAGCCTGG + Intergenic
1017064224 6:150514382-150514404 TGTGCCACTGACCTCCAGCCTGG - Intergenic
1017727591 6:157286227-157286249 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1017842939 6:158236855-158236877 GGGGCCACTGCACTCCAGCCTGG - Intronic
1018032252 6:159850751-159850773 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1018108122 6:160508303-160508325 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1018186496 6:161269599-161269621 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1018322057 6:162621857-162621879 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1018692807 6:166362623-166362645 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1018701501 6:166430966-166430988 GGCGCCACTGCACTTCAGCCTGG - Intronic
1018937398 6:168282793-168282815 TGTGCCACTGAACTTCAGCCTGG + Intergenic
1019463642 7:1174644-1174666 TGTGCCACTGCCCTTCAGCCTGG - Intergenic
1019525184 7:1477538-1477560 GGTGCCACCCACCTTCCTCCGGG + Exonic
1019623865 7:2005755-2005777 TGGGCCACTGCACTTCAGCCTGG + Intronic
1019703348 7:2485487-2485509 GGAGCCACTGCACTTCAGCCTGG + Intergenic
1020064007 7:5173746-5173768 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1020199146 7:6065669-6065691 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1020724819 7:11798964-11798986 TGGGCCACTGAACTCCAGCCTGG - Intronic
1020861918 7:13503862-13503884 GGTGCCACTCTACTCCAGCCTGG + Intergenic
1020964937 7:14853822-14853844 TGGGCCACTGCACTTCAGCCTGG + Intronic
1020966700 7:14878703-14878725 TGGGCCACTGCCCTCCAGCCTGG + Intronic
1021044268 7:15903218-15903240 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1021365389 7:19772591-19772613 GGGGGCGGTCAGCTTCAGCCTGG - Exonic
1021622237 7:22560315-22560337 GCGGCCTCTCTCCTTTAGCCTGG + Intronic
1021996856 7:26187408-26187430 GGGGCCACTGCACTTCAGCATGG - Intergenic
1022186981 7:27979430-27979452 GGGGCCACTGCACTCCAGCCTGG - Intronic
1022449842 7:30504557-30504579 GGGGGCACTCACCTGCAGGCGGG + Exonic
1022479798 7:30735306-30735328 GGTGCCACTGCACTTCAGCCTGG + Intronic
1022662066 7:32376729-32376751 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1022663886 7:32390807-32390829 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1023040362 7:36167757-36167779 GGCGCCACTGCACTTCAGCCTGG - Intronic
1023178862 7:37460823-37460845 CGCGCCACTGAACTTCAGCCTGG - Intergenic
1023448513 7:40256785-40256807 GGCACCACTGCCCTTCAGCCTGG - Intronic
1023687968 7:42756003-42756025 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1023827593 7:44019829-44019851 GGCGCCACTGTACTTCAGCCTGG - Intergenic
1023828390 7:44024875-44024897 CGGGCCACTCCACTCCAGCCTGG - Intergenic
1024670711 7:51591812-51591834 GGTGCCACTTTACTTCAGCCTGG - Intergenic
1024793413 7:52993307-52993329 TGGGCCACTGCACTTCAGCCTGG + Intergenic
1024793804 7:52998848-52998870 GGCGCCACTGAGCTCCAGCCTGG - Intergenic
1025163700 7:56690879-56690901 TGGGCCACTGAACTCCAGCCTGG + Intergenic
1025173576 7:56783509-56783531 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1025619673 7:63157101-63157123 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1025698526 7:63794644-63794666 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1025737937 7:64169669-64169691 GGCGCCACTGAACTCCAGCCTGG - Intronic
1025852308 7:65253489-65253511 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1026128161 7:67597750-67597772 TGGGCCACTCTACTCCAGCCTGG - Intergenic
1026208247 7:68278639-68278661 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1026237869 7:68544247-68544269 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1026514346 7:71055077-71055099 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1026639467 7:72111499-72111521 GGTGCCACTGCACTTCAGCCTGG - Intronic
1026659941 7:72291956-72291978 GGGGCCACCGCACTTCAGCCTGG + Intronic
1026736774 7:72954009-72954031 GTGGCCACTGCACTTCAGCCTGG - Intergenic
1026759583 7:73116489-73116511 GGCACCACTCAACTCCAGCCTGG - Intergenic
1026765820 7:73158911-73158933 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1026937160 7:74264276-74264298 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1027042294 7:74968608-74968630 GGTGCCACTGTACTTCAGCCTGG - Intronic
1027081348 7:75233750-75233772 GGTGCCACTGTACTTCAGCCTGG + Intergenic
1027087827 7:75276984-75277006 GGCACCACTCAACTCCAGCCTGG + Intergenic
1027106960 7:75411054-75411076 GTGGCCACTGCACTTCAGCCTGG + Intergenic
1027347766 7:77279218-77279240 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1027466280 7:78518774-78518796 GGTGCCACTGCACTTCAGCCTGG - Intronic
1027646978 7:80814130-80814152 GTGGCCACTGAACTCCAGCCTGG - Intronic
1028029499 7:85892223-85892245 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1028072807 7:86473507-86473529 GGGGCCACTGGCCTTTACCCAGG + Intergenic
1028411651 7:90536825-90536847 GGGGCCACTCTCCATCAGCAGGG + Intronic
1028552253 7:92082008-92082030 TGCGCCACTAAACTTCAGCCTGG - Intronic
1028570584 7:92282195-92282217 GGCGCCACTCAACTCCAGTCTGG - Intronic
1028612094 7:92723130-92723152 AGGGCCACTGCCCTCCAGCCTGG + Intronic
1029090680 7:98045815-98045837 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1029119703 7:98259134-98259156 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1029199544 7:98829387-98829409 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1029205451 7:98867051-98867073 GGCGCCCCTGCCCTTCAGCCTGG + Intronic
1029286243 7:99468138-99468160 GGGGCCACTGCACTGCAGCCTGG + Intergenic
1029389933 7:100268350-100268372 GGTGCCACTGTACTTCAGCCTGG + Intronic
1029393937 7:100294132-100294154 GGCACCACTCAACTCCAGCCTGG + Intergenic
1029428600 7:100514142-100514164 GGTGCCACTGAGCTCCAGCCTGG - Intergenic
1029710806 7:102298621-102298643 GGGGCCACTGTACTCCAGCCTGG - Intronic
1029738767 7:102479598-102479620 GGCGCCACTGTACTTCAGCCTGG - Intergenic
1029755893 7:102573255-102573277 GGCGCCACTGTACTTCAGCCTGG - Intronic
1029756690 7:102578302-102578324 CGGGCCACTCCACTCCAGCCTGG - Intronic
1029773835 7:102672328-102672350 GGCGCCACTGTACTTCAGCCTGG - Intergenic
1029774630 7:102677371-102677393 CGGGCCACTCCACTCCAGCCTGG - Intergenic
1030048475 7:105518267-105518289 GGTGCCACTACACTTCAGCCTGG + Intronic
1030446829 7:109656073-109656095 GTGGCCACTGAGCTCCAGCCTGG + Intergenic
1031197848 7:118639499-118639521 TGCGCCACTCAACTCCAGCCTGG - Intergenic
1031980943 7:128123869-128123891 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1032024846 7:128432969-128432991 TGCGCCACTGTCCTTCAGCCTGG - Intergenic
1032109590 7:129064406-129064428 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1032153751 7:129451737-129451759 GTGGTCACTCACCTTGGGCCAGG - Exonic
1032658987 7:133962482-133962504 GGGGCTACATAGCTTCAGCCCGG + Intronic
1033105970 7:138523705-138523727 GGGGCCACTGCACTCCAGCCTGG + Intronic
1033328945 7:140402163-140402185 GGTGCCACTGCACTTCAGCCTGG + Intronic
1033329122 7:140403615-140403637 GGTGCCACTGCACTTCAGCCTGG + Intronic
1033395429 7:140969926-140969948 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1034024795 7:147689191-147689213 TGTGCCACTGAACTTCAGCCTGG - Intronic
1034153930 7:148938843-148938865 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1034197851 7:149262013-149262035 GCGGCCACCCACCCTCACCCGGG - Intergenic
1034509555 7:151522478-151522500 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1034968298 7:155404647-155404669 GGAGTCACCCACCTCCAGCCTGG - Intergenic
1035148404 7:156843790-156843812 GGGGCCACTGCACTCCAGCCTGG + Intronic
1035184393 7:157114619-157114641 TGTGCCACTGACCTCCAGCCTGG - Intergenic
1035193892 7:157198576-157198598 GGCGCCACTGCACTTCAGCCTGG - Intronic
1035204133 7:157283670-157283692 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1035431519 7:158826775-158826797 GGTGCCACTGCACTTCAGCCTGG + Intronic
1035734676 8:1879594-1879616 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1035790465 8:2299120-2299142 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1035802340 8:2422585-2422607 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1035845204 8:2856686-2856708 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1035919216 8:3658737-3658759 CGTGCCACTGAACTTCAGCCTGG + Intronic
1036168617 8:6461367-6461389 TGGGCCACTGCACTTCAGCCTGG - Intronic
1036437644 8:8749790-8749812 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1036440577 8:8778139-8778161 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1036508851 8:9382035-9382057 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1036516531 8:9449645-9449667 GGCGCCACTCTGCTCCAGCCTGG - Intergenic
1036540259 8:9700975-9700997 GGGGCCACTGCACTGCAGCCTGG - Intronic
1036645433 8:10609198-10609220 GGGGCCCCTCTCCTTCACCCTGG - Exonic
1036670554 8:10782690-10782712 GGTGCCACTACCCTTCAACCTGG + Intronic
1037064396 8:14558529-14558551 GGTGCCACTGCACTTCAGCCTGG + Intronic
1037506047 8:19530685-19530707 TGTGCCACTGCCCTTCAGCCTGG + Intronic
1037740289 8:21603450-21603472 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1037781132 8:21869817-21869839 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1038040498 8:23720233-23720255 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1038194575 8:25355188-25355210 GGTGCCACTGTGCTTCAGCCTGG + Intronic
1038276461 8:26125472-26125494 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
1038353012 8:26798020-26798042 GGTGCCACTGAACTCCAGCCTGG - Intronic
1038668683 8:29563673-29563695 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1038769243 8:30461436-30461458 TGGGCCACTGAACTCCAGCCTGG - Intronic
1038930271 8:32186415-32186437 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1038953641 8:32444160-32444182 AGGGCCACTGCCCTTCTGCCTGG - Intronic
1038956557 8:32474534-32474556 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1039258498 8:35745008-35745030 GGTGCCACTGCACTTCAGCCTGG + Intronic
1039477465 8:37847571-37847593 GGCGCCACTGCACTTCAGCCTGG - Intronic
1039526352 8:38219859-38219881 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1039573932 8:38608600-38608622 CGTGCCACTGCCCTTCAGCCTGG - Intergenic
1039574818 8:38614496-38614518 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1039744211 8:40409223-40409245 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1039948480 8:42150158-42150180 AGGGCCACTGAGCTTCAGCATGG - Intergenic
1040418187 8:47214996-47215018 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1040658268 8:49538444-49538466 GGCGCCACTGAACTCCAGCCTGG + Intronic
1040660485 8:49569662-49569684 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1040894414 8:52350762-52350784 TGGGCCACTGCACTTCAGCCTGG - Intronic
1041096193 8:54352663-54352685 GGAGCCACTGCACTTCAGCCTGG - Intergenic
1041211731 8:55559129-55559151 TGGGCCACTGAACTCCAGCCTGG - Intergenic
1041573432 8:59365149-59365171 CGGGCCACTGTACTTCAGCCTGG + Intergenic
1042546094 8:69952849-69952871 CGGGCCACTGCCCTCCAGCCTGG + Intergenic
1042574992 8:70207817-70207839 GGCGCCACTGAACTCCAGCCTGG + Intronic
1042834443 8:73065733-73065755 GGGGCCACTGCACTCCAGCCTGG + Exonic
1042922142 8:73930554-73930576 GGGGCCACTGAACTCCAGCCTGG - Intergenic
1043020224 8:74991034-74991056 TGTGCCACTGCCCTTCAGCCTGG - Intronic
1043096381 8:75980189-75980211 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1043141673 8:76597773-76597795 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1043164104 8:76881855-76881877 GAGGCCACTCACACTCAGGCTGG + Intergenic
1043681041 8:83024618-83024640 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1043712356 8:83438005-83438027 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1043735296 8:83733508-83733530 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1043977317 8:86597932-86597954 GGTGCCACTGAACTCCAGCCTGG + Intronic
1044080655 8:87878829-87878851 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1044595954 8:93958757-93958779 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1044665923 8:94634503-94634525 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1044908520 8:97031228-97031250 GGTGCCACTCCACTCCAGCCTGG - Intronic
1045211465 8:100104273-100104295 GGGGCCACTACACTCCAGCCTGG + Intronic
1045292310 8:100844107-100844129 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1045511787 8:102817305-102817327 GATGCCACTAACCTCCAGCCTGG + Intergenic
1045584347 8:103514852-103514874 GGCGCCACTGCACTTCAGCCTGG + Intronic
1045748494 8:105453683-105453705 GGGGCCACTGCACTTCAGCCTGG - Intronic
1045821304 8:106341917-106341939 GGAGCCACTAAACTCCAGCCTGG - Intronic
1045843428 8:106605753-106605775 GGTGCCACTGCACTTCAGCCTGG + Intronic
1046123175 8:109870222-109870244 TGCGCCACTAACCTCCAGCCTGG + Intergenic
1046201187 8:110929386-110929408 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1046944165 8:119959204-119959226 GGCGCCACTTCCCTCCAGCCTGG - Intronic
1046946976 8:119983426-119983448 GGCGCCACTCCACTCCAGCCTGG - Intronic
1046984046 8:120367898-120367920 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1047761725 8:127959539-127959561 GGCGCCACTCTACTCCAGCCTGG + Intergenic
1048788274 8:138075544-138075566 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1049256657 8:141617724-141617746 AGGGACACACACCTGCAGCCTGG - Intergenic
1049256674 8:141617806-141617828 AGGGACACACACCTGCAGCCTGG - Intergenic
1049377632 8:142296599-142296621 AGGGCCGCTCACCTTCTGTCAGG + Intronic
1049467198 8:142756992-142757014 GGGGCCTCTCCCCTGCACCCAGG + Intergenic
1049579868 8:143406426-143406448 GGGGCCCCTCCCCTTCAGCCAGG + Intergenic
1049739372 8:144229425-144229447 GGAGCCACTGAACTCCAGCCTGG - Intronic
1049820002 8:144627712-144627734 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1049966176 9:782202-782224 TGGGCCACTCCACTCCAGCCTGG - Intergenic
1050338546 9:4613182-4613204 GGGGCCACTGTACTCCAGCCTGG + Intronic
1050367556 9:4886446-4886468 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1050496006 9:6243396-6243418 GGTGCCACTGCACTTCAGCCTGG - Intronic
1050707722 9:8422101-8422123 GGTGCCACTGCACTTCAGCCTGG + Intronic
1050910294 9:11059774-11059796 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1051947396 9:22586807-22586829 GGCGCCACTCTGCTCCAGCCTGG - Intergenic
1052476407 9:28966087-28966109 GGGGCCAATCACCTTCCTCTGGG - Intergenic
1052933413 9:34074181-34074203 GGGGCCACTCCACTCCAGCCTGG + Intergenic
1052965412 9:34337041-34337063 GGGGCCACTGAATTCCAGCCTGG - Intronic
1053222929 9:36326680-36326702 TGCGCCACTGAACTTCAGCCTGG + Intergenic
1053238937 9:36480593-36480615 GGTGCCACTGCCCTCCAGCCTGG - Intronic
1053369489 9:37548790-37548812 GGCGCCACTGCACTTCAGCCTGG - Intronic
1053385158 9:37681167-37681189 GGGGCCACTGCACTCCAGCCTGG + Intronic
1053397857 9:37790871-37790893 GGAGCCTCTCGCCTCCAGCCAGG + Intronic
1053538022 9:38945692-38945714 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1053547272 9:39036501-39036523 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1054628112 9:67418229-67418251 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1055031661 9:71776169-71776191 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1055198661 9:73628779-73628801 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1055317887 9:75052534-75052556 GGTGCCACTGTACTTCAGCCTGG - Intergenic
1055792583 9:79938315-79938337 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1055870421 9:80871252-80871274 GGTGCCACTGCACTTCAGCCTGG + Intergenic
1056023474 9:82465940-82465962 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1056098001 9:83273857-83273879 TGGGCCACTGAACTCCAGCCTGG - Intronic
1056102921 9:83317081-83317103 CGTGCCACTGTCCTTCAGCCTGG + Intronic
1056193988 9:84211452-84211474 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1056289377 9:85127391-85127413 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1056549176 9:87637135-87637157 TGTGCCACTGCCCTTCAGCCTGG - Intronic
1056977148 9:91268472-91268494 GGCGCCACTGCACTTCAGCCTGG - Intronic
1057318954 9:93994366-93994388 GGGGTCACTGACCTCCTGCCTGG + Intergenic
1057486608 9:95489842-95489864 GGGGCCACTGCACTCCAGCCTGG - Intronic
1057508163 9:95653888-95653910 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1057530662 9:95842709-95842731 GGCGCCACTGCCCTCCAGCCTGG + Intergenic
1057591778 9:96379261-96379283 GGTGCCACTGCACTTCAGCCTGG + Intronic
1057884129 9:98816864-98816886 GGGGCCACTGCACTCCAGCCTGG - Intronic
1058190221 9:101905318-101905340 AGGACCACTCCCCATCAGCCCGG - Intergenic
1058559808 9:106214560-106214582 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1058691597 9:107524932-107524954 GGCGCCACTCTCCTCCATCCTGG - Intergenic
1058729037 9:107832333-107832355 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1058849208 9:108994185-108994207 GGCGCCACTGCACTTCAGCCTGG + Intronic
1058986943 9:110217358-110217380 TGTGCCACTGCCCTTCAGCCTGG + Intergenic
1059031907 9:110706958-110706980 GGAGCCACTGAACTCCAGCCTGG + Intronic
1059090451 9:111351899-111351921 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1059163285 9:112055381-112055403 TGGGCCACTGCACTTCAGCCTGG + Intronic
1059302947 9:113330142-113330164 CGGGCCACTGTCCTCCAGCCTGG - Intronic
1059364986 9:113779986-113780008 TGGGCCACTGTACTTCAGCCTGG - Intergenic
1059448588 9:114355949-114355971 GAGGGCACCCAACTTCAGCCTGG - Exonic
1059474998 9:114539286-114539308 TGTGCCACTACCCTTCAGCCTGG + Intergenic
1059756237 9:117296232-117296254 GGTGCCACTGCACTTCAGCCTGG + Intronic
1059979216 9:119751170-119751192 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1060598202 9:124860882-124860904 GGGGCCACTGCTCTTCAGTCTGG - Intronic
1060616640 9:125022453-125022475 GGTGCCACTGCACTTCAGCCTGG - Intronic
1060700156 9:125744399-125744421 TGTGCCACTCCCCTCCAGCCTGG - Intergenic
1060913806 9:127371974-127371996 CGCGCCACTGAACTTCAGCCTGG - Intronic
1061158614 9:128880483-128880505 TGGGCCACTGCACTTCAGCCTGG - Intronic
1061183687 9:129039784-129039806 GGGGCCACTGCGCTCCAGCCTGG - Intronic
1061265501 9:129502625-129502647 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1061582179 9:131545050-131545072 GGCGCCACTGAACTCCAGCCTGG + Intergenic
1061742189 9:132715405-132715427 GGTGCCACTGCCCTCCAGCCTGG + Intergenic
1061823652 9:133242963-133242985 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1061985254 9:134126831-134126853 GGCGCCACTCCACTCCAGCCTGG - Intergenic
1062654495 9:137595893-137595915 GGGGCCACTGCCCTCCAGCCTGG + Intergenic
1185473723 X:400612-400634 GGGGCCACTGCTCTCCAGCCTGG - Intergenic
1185652019 X:1655031-1655053 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1185737906 X:2507019-2507041 GGAGCCACTGCACTTCAGCCTGG + Intergenic
1185834778 X:3335238-3335260 GGCGCCACTGCACTTCAGCCTGG - Intronic
1186345659 X:8689662-8689684 GGTGCCACTGCACTTCAGCCTGG + Intronic
1186418269 X:9402195-9402217 GGTGCCACTGAACTCCAGCCTGG + Intergenic
1186482801 X:9908899-9908921 GGTGCCACTGCACTTCAGCCTGG + Intronic
1186661287 X:11669982-11670004 GGCGCCACTGCCCTCCAGCCTGG - Intergenic
1186668006 X:11738587-11738609 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1186732196 X:12421716-12421738 TGGGCCACTATACTTCAGCCTGG + Intronic
1187334502 X:18370437-18370459 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1187907547 X:24081755-24081777 GGCGCCACTGCACTTCAGCCTGG + Intergenic
1188304519 X:28546256-28546278 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1188474101 X:30571582-30571604 CGGGCCACTGCCCTTCAGCCGGG + Intronic
1188580245 X:31702896-31702918 GGTGCCACTGCACTTCAGCCTGG - Intronic
1188672799 X:32900383-32900405 AGTGCCACTAAACTTCAGCCTGG - Intronic
1188770279 X:34145792-34145814 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1188844169 X:35053393-35053415 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1188976215 X:36679212-36679234 GGGGCCACTGCACCTCAGCCTGG - Intergenic
1189131232 X:38499788-38499810 GGTGCCACTGCCCTCCAGCCTGG + Intronic
1189367507 X:40400325-40400347 GGCGCCACTCCACTCCAGCCTGG - Intergenic
1189449736 X:41117899-41117921 GGTGCCACTGAACTCCAGCCTGG - Intronic
1189450079 X:41120880-41120902 GGGGCCACTGCACTCCAGCCTGG - Intronic
1189476396 X:41359551-41359573 GGTGCCACTGCACTTCAGCCTGG + Intronic
1189483856 X:41413919-41413941 CGGGCCACTGAGCTCCAGCCTGG + Intergenic
1190016835 X:46834984-46835006 GGCGCCACTCCACTCCAGCCTGG - Intergenic
1190085771 X:47394004-47394026 CGTGCCACTGCCCTTCAGCCTGG - Intronic
1190306497 X:49085808-49085830 GGGGCCATTGCACTTCAGCCTGG + Intronic
1190374716 X:49777433-49777455 GGTGCCACTCTTCTCCAGCCTGG + Intergenic
1190930358 X:54943705-54943727 GGGGCCACTGCACTCCAGCCTGG + Intronic
1191027024 X:55924897-55924919 GGCGCCACTGAGCTCCAGCCTGG - Intergenic
1191108763 X:56788975-56788997 AGGGACACTCGCCTTCTGCCAGG - Intergenic
1191852016 X:65592237-65592259 GGCGCCACTGAACTCCAGCCTGG - Intronic
1192742691 X:73908690-73908712 CGTGCCACTGCCCTTCAGCCTGG - Intergenic
1192804840 X:74499495-74499517 TGGGCCACTGAACTCCAGCCTGG - Intronic
1193332158 X:80246917-80246939 GGCGCCACTGCACTTCAGCCTGG - Intergenic
1193375261 X:80752711-80752733 GGTGCCACTGCACTTCAGCCTGG - Intronic
1193434586 X:81456667-81456689 AGGGCCACTGCACTTCAGCCTGG + Intergenic
1194124356 X:89995686-89995708 GGCGCCACTGAACTCCAGCCTGG - Intergenic
1195090869 X:101457784-101457806 GGTGCCACTGCACTTCAGCCTGG - Intronic
1195142095 X:101971891-101971913 GGTGCCACTGAACTCCAGCCTGG - Intergenic
1195264936 X:103171141-103171163 GGCGCCACTCCACTCCAGCCTGG - Intergenic
1195745234 X:108110945-108110967 GGTGCCACTGAACTCCAGCCTGG - Intronic
1196049807 X:111292927-111292949 GGTGCCACTGCCCTCCAGCCTGG - Intergenic
1196417263 X:115484724-115484746 TGGGCCACTGCCCTCCAGCCCGG - Intergenic
1196431110 X:115626891-115626913 TGGGCCACTGCACTTCAGCCTGG - Intronic
1196531674 X:116795005-116795027 GGTGCCACTGCACTTCAGCCTGG - Intergenic
1196614217 X:117748998-117749020 CGCGCCACTGAACTTCAGCCTGG + Intergenic
1196885318 X:120239226-120239248 CGAGCCACTGCCCTTCAGCCTGG + Intergenic
1196891233 X:120292714-120292736 GGTGCCACTCCACTCCAGCCTGG + Intronic
1197423018 X:126261926-126261948 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1197783990 X:130182946-130182968 CGGGCCACTGCACTTCAGCCTGG - Intronic
1198127559 X:133661123-133661145 TGTGCCACTGACCTCCAGCCTGG + Intronic
1198321083 X:135519856-135519878 GGGGCCACTGCACTCCAGCCTGG + Intergenic
1198397550 X:136235703-136235725 GGCGCCACTGCCCTCCAGCCTGG + Intronic
1198472844 X:136965339-136965361 TGGGCCACTGCTCTTCAGCCTGG - Intergenic
1198690163 X:139274108-139274130 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1199085012 X:143618147-143618169 GGGGCCACTGCACTCCAGCCTGG - Intergenic
1199288982 X:146085113-146085135 GTGGCCACTGCACTTCAGCCTGG + Intergenic
1199690638 X:150306605-150306627 GGGGCCTTTTACTTTCAGCCAGG + Intergenic
1200101664 X:153691611-153691633 AGGGCCACTCCCCTGGAGCCGGG - Intronic
1200119550 X:153783874-153783896 GTGGCCCCTCACCCTCAGCCTGG - Exonic
1200240844 X:154492602-154492624 CGCGCCACTCTCCTCCAGCCTGG + Intergenic
1200977191 Y:9225986-9226008 GGCGCCACTGATCTCCAGCCTGG - Intergenic
1201014679 Y:9588588-9588610 GGTGCCACTGAACTGCAGCCTGG + Intergenic
1202581261 Y:26383040-26383062 TGTGCCACTGCCCTTCAGCCTGG + Intergenic