ID: 1152068500

View in Genome Browser
Species Human (GRCh38)
Location 17:78124167-78124189
Sequence GGGTGAAGCAACCCTGCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152068499_1152068500 -4 Left 1152068499 17:78124148-78124170 CCGTAGTACATGACGGTGTGGGT 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1152068500 17:78124167-78124189 GGGTGAAGCAACCCTGCCACAGG 0: 1
1: 0
2: 2
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152068500 Original CRISPR GGGTGAAGCAACCCTGCCAC AGG Exonic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900368087 1:2319645-2319667 GGGAGACGCAGCCTTGCCACTGG + Intergenic
902618082 1:17634780-17634802 GGCTGCAGCCACCCTGCCCCAGG - Intronic
903036052 1:20493274-20493296 AGGGGAAGAAACCCTTCCACAGG + Intergenic
903761569 1:25702282-25702304 GGATGAAGCCACACTGCCAGGGG - Intronic
903904294 1:26672854-26672876 GGCTCAAGCAATCCTCCCACTGG + Intergenic
904439682 1:30522135-30522157 GGGTGGAGGAGCCCTGCCAGGGG - Intergenic
905236457 1:36553450-36553472 GGGAGAAGCAATTCTGGCACTGG - Intergenic
907405526 1:54251443-54251465 GCGTGAAGCCAGCCTGCCACAGG + Intronic
907493526 1:54826187-54826209 GTGTGCAGCAGCTCTGCCACTGG + Intronic
915977975 1:160402899-160402921 GGGTGCCTCAACCCAGCCACTGG - Intronic
918467035 1:184831073-184831095 GGGTGAAGCAGCCATGTGACTGG + Intronic
923173619 1:231441892-231441914 GGGTGAAGCATCCCAGGCAGAGG + Intergenic
923913224 1:238472756-238472778 TGGTGAAGCAGCCCTGCCTTGGG - Intergenic
1064450731 10:15439970-15439992 GGCTAAAGCAACCCTGGCAGAGG + Intergenic
1064550903 10:16499962-16499984 GGCTCAAGCAACCCTCCCAGAGG + Intronic
1064703617 10:18047773-18047795 GGATGAACCACCCCTTCCACTGG - Intergenic
1067469101 10:46523394-46523416 GGCTGAAGCATGCCTGCCAGTGG + Intergenic
1067877845 10:50020465-50020487 GGGTGGAGCCACCCCGGCACTGG - Intergenic
1068528617 10:58159434-58159456 GGGTAAAGTGACCCAGCCACAGG - Intergenic
1070132233 10:73663936-73663958 GGGCGGAGCCACCCTGGCACTGG + Intergenic
1071609449 10:87020139-87020161 GGGCGGAGCCACCCTGGCACTGG - Intergenic
1074731753 10:116385488-116385510 GGGTGGAGCAACCCAGGCAGAGG - Intergenic
1077168566 11:1154474-1154496 GGGTGGACCACCCCAGCCACTGG - Intergenic
1077293716 11:1814096-1814118 GGAAGAAACAGCCCTGCCACAGG - Intergenic
1077797799 11:5509528-5509550 AGGTGGAGAAGCCCTGCCACAGG - Exonic
1081545406 11:44067918-44067940 GAGTGAAGCTCCCCTCCCACTGG + Intronic
1081928866 11:46853935-46853957 GGTTGAAGCATCCCTACCATGGG + Intergenic
1082801410 11:57417664-57417686 GGGTAAAGCAAACCTATCACAGG - Intronic
1083215235 11:61214559-61214581 GGGAAAAGCAACCCTGGCAAAGG - Intergenic
1083218119 11:61233388-61233410 GGGAAAAGCAACCCTGGCAAAGG - Intergenic
1083223972 11:61273223-61273245 AGGTGAAGCAACACTGCCCAGGG + Exonic
1084548492 11:69826347-69826369 GGGTCATGCCACCCTGCCAGGGG - Intergenic
1084996918 11:72989736-72989758 GGGCCAAGCAACACTGCCTCAGG + Intronic
1087622982 11:100563766-100563788 GGTTAAAGAAACACTGCCACGGG + Intergenic
1088824782 11:113484356-113484378 GGGGAAAGCCACCCTGCCTCAGG + Intergenic
1089298775 11:117485339-117485361 GGGTGAAGGGACCCTGTCTCAGG - Intronic
1091453349 12:587262-587284 GGGTGAAGCTGCCCCTCCACAGG + Intronic
1091682761 12:2538917-2538939 GGCTGGAGCAACCCTGCTACAGG + Intronic
1093467272 12:19462636-19462658 AGTTGAAGCAAGCCTGGCACTGG - Exonic
1095946889 12:47758779-47758801 GGGGGACGCCACCCAGCCACCGG + Intronic
1097192350 12:57225576-57225598 CGGTGAAGCACACCTGCGACGGG - Exonic
1097314280 12:58155221-58155243 GAGTGGAGAGACCCTGCCACTGG + Intergenic
1097901225 12:64875520-64875542 GGGTGCACCCACCCTGCCAGCGG + Exonic
1098488729 12:71050627-71050649 GGGTGAAGCATCACTGCCTGGGG + Intronic
1100630046 12:96379517-96379539 GGATTAAGCAATCCTTCCACAGG + Intronic
1102290587 12:111696156-111696178 GGCTCAAGCAATCCTGCCTCAGG + Intronic
1106452828 13:29898810-29898832 GGATGGAGCAAACCTGCCTCTGG - Intergenic
1107119105 13:36778536-36778558 GGGTGGAGCCACCCTGAAACAGG + Intergenic
1107543286 13:41413258-41413280 AGGAGAAGCCACCCTGGCACCGG - Intergenic
1108875910 13:55050736-55050758 TGATCAAGCAATCCTGCCACTGG + Intergenic
1109699531 13:66007691-66007713 GGGTGAAGTAAGCCTACCCCTGG - Intergenic
1110584680 13:77175050-77175072 GGCTCAAGCAATCCTCCCACCGG + Intronic
1111123139 13:83879958-83879980 TGGTCCAGCACCCCTGCCACCGG + Exonic
1111863751 13:93742040-93742062 GGGTGAATTAATCCTGACACAGG - Intronic
1112711351 13:102132596-102132618 GGTTCAAGCAATTCTGCCACAGG + Intronic
1117707642 14:58488038-58488060 GGGTGATGGAGACCTGCCACTGG + Exonic
1119702615 14:76765547-76765569 GGGTCAGCCCACCCTGCCACTGG - Intronic
1120527972 14:85599787-85599809 AGGTGAAGAAACCAGGCCACAGG + Intronic
1120586817 14:86322133-86322155 AGGTCAAGCACCCCTGCCAGAGG + Intergenic
1124410304 15:29431166-29431188 GGGTTACGTAACCCGGCCACTGG - Intronic
1124709902 15:31999400-31999422 TTGTGAAGCTTCCCTGCCACAGG - Intergenic
1129517551 15:76165890-76165912 GTGTGAGGCGACCCTGCCCCGGG - Intronic
1131749920 15:95495343-95495365 GGGTGCAGCGGCCCTGCCAGGGG - Intergenic
1133217005 16:4298742-4298764 GGCTCAAGCAATCCTGCCTCAGG + Intergenic
1135050711 16:19190663-19190685 GAGTGAAACAAGCCAGCCACAGG - Intronic
1139325782 16:66151700-66151722 GGGTGAATGAACCCTGCTTCTGG - Intergenic
1142085323 16:88176963-88176985 GGATGAGGCTTCCCTGCCACGGG - Intergenic
1143190030 17:5034157-5034179 GAGTGGAGCTGCCCTGCCACTGG + Exonic
1145277754 17:21444922-21444944 GGCTGCAGCTACCCTGCCCCTGG + Intergenic
1145315585 17:21730801-21730823 GGCTGCAGCTACCCTGCCCCTGG + Intergenic
1145714022 17:27002740-27002762 GGCTGCAGCTACCCTGCCCCTGG + Intergenic
1146726401 17:35159782-35159804 GGGTGAAGCAACCTAGCAAATGG + Intronic
1149441511 17:56678341-56678363 GGGTGAAGCACCCATGCCAAAGG + Intergenic
1150702499 17:67460139-67460161 GGGTGCAGAATACCTGCCACAGG - Intronic
1150730560 17:67689361-67689383 GGGTGAAAGATGCCTGCCACCGG + Intronic
1151489657 17:74425201-74425223 GGGAGACACAGCCCTGCCACAGG + Intronic
1152068500 17:78124167-78124189 GGGTGAAGCAACCCTGCCACAGG + Exonic
1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG + Intergenic
1152769590 17:82158947-82158969 GGCTCAAGCAACCCTCCCACTGG + Intronic
1158327054 18:56323765-56323787 CGGTGCAGGAACCCAGCCACTGG - Intergenic
1161325597 19:3662186-3662208 GGATGAAGCCACCCTCCCTCGGG + Intronic
1161572116 19:5036383-5036405 GGGTGCAGGAAGCCTTCCACTGG + Intronic
1163276965 19:16290953-16290975 GCTGGAAGCAACCCTGCCAGGGG + Intergenic
1168099090 19:54131517-54131539 GGGAGAACCTGCCCTGCCACTGG + Exonic
926633984 2:15161628-15161650 GGGTGAAACAACCCAGGCTCAGG - Intergenic
927450286 2:23203428-23203450 GGGTGAAGCAAAACTGACAGTGG - Intergenic
928342337 2:30455674-30455696 GGATGAAGCAATCCTCCCAGAGG - Intronic
930240620 2:48932317-48932339 AGGTTAAGCAACTCTGCCAAGGG - Intergenic
930725211 2:54675348-54675370 GGGAGCTGCAACCCCGCCACGGG - Intergenic
931818936 2:65932367-65932389 AGGAGAAGCCATCCTGCCACAGG - Intergenic
933940249 2:87239294-87239316 GCTTGAAGCAAGCCTGCCACAGG - Intergenic
935085958 2:99845578-99845600 GGGTGAAGAAACCATGTTACAGG + Intronic
935338303 2:102036841-102036863 AGGTGAAACAACAATGCCACTGG + Intergenic
936352889 2:111726482-111726504 GCTTGAAGCAAGCCTGCCACAGG + Intergenic
937557804 2:123180697-123180719 GGGTGAAGCCCCTCTGCCAGTGG + Intergenic
942594202 2:177576927-177576949 GGCTCAAGCAATCCTGCCACTGG - Intergenic
945011126 2:205464803-205464825 GGGTGATTAAACCCTGCAACAGG - Intronic
948423520 2:237874654-237874676 GAGTGAAGCAAGCGTGCCTCAGG - Intronic
948557415 2:238822841-238822863 TGGTGAGGCAACCATGCCACAGG + Intergenic
1174145807 20:48451702-48451724 GGGGGAAGCAACTCTTCCAAGGG + Intergenic
1176045073 20:63088316-63088338 GGATGAAGCAACCCCTCCAGGGG + Intergenic
1177401099 21:20606100-20606122 GGGTGAGGCTCCCCTGCCATTGG + Intergenic
1179049518 21:37876867-37876889 GGTTGAAGCAAGCTTGCCTCAGG - Intronic
1182248793 22:28983082-28983104 GGGTAAAGCGTCCCTCCCACTGG + Intronic
1183706420 22:39477390-39477412 GGGTGAAGCAGCCCCGCAATTGG + Intronic
949155925 3:827243-827265 GGGTGAGGCAACTCTGCCTTTGG + Intergenic
950581989 3:13868376-13868398 GGCTCAAGCAATCCTTCCACTGG - Intronic
954363338 3:50133866-50133888 TGGGGAGGCATCCCTGCCACAGG - Intergenic
954437983 3:50505953-50505975 AGGTGAAGCTACCCTGACAGGGG + Intergenic
956303533 3:67798531-67798553 TGGTCCAGCAATCCTGCCACTGG - Intergenic
960785767 3:121371804-121371826 CTGTGCAGCAACACTGCCACTGG - Intronic
961826830 3:129603566-129603588 GGATGAACCAACCATGGCACAGG + Intronic
969305438 4:6323702-6323724 GGCTGAAGCAATCCTCCCACCGG - Intronic
976559857 4:86488855-86488877 GGGAGGAGCTACACTGCCACAGG - Intronic
979059098 4:116032381-116032403 GGTTGAAGCAATCCTCCCACAGG - Intergenic
980064726 4:128173207-128173229 GGCTGAAACTAGCCTGCCACGGG + Intronic
985640709 5:1062243-1062265 GGGAGAACCAGCCCTGCCAGGGG - Intronic
986208223 5:5646032-5646054 GGGGCAGGCAGCCCTGCCACAGG - Intergenic
992431751 5:76716613-76716635 GGGTGCAGCCCGCCTGCCACGGG + Intronic
997109410 5:131058406-131058428 GGTTGAAGCAACCATGCCACTGG + Intergenic
998102169 5:139443619-139443641 GGTTCAAGCAATCCTGCCCCCGG + Intronic
1000263218 5:159610079-159610101 GGGAGAAGCAAGCCTGCTGCAGG - Intergenic
1000454978 5:161437794-161437816 GGGTGAGGCTATCCTGCCATTGG + Intronic
1000705098 5:164501254-164501276 GGGTGAAGGAATCCTGCTATGGG - Intergenic
1001329326 5:170751439-170751461 GGTTCACCCAACCCTGCCACAGG - Intergenic
1005215178 6:23518395-23518417 GGCTCAAGCAATCCTCCCACTGG + Intergenic
1006514400 6:34538066-34538088 GGAGGAAGCACCCCTGCCCCAGG + Exonic
1007503840 6:42319089-42319111 AGGTGGAGAAACACTGCCACAGG - Intronic
1009854584 6:69245630-69245652 GGGTGAAGGAACAGTGCCCCAGG - Intronic
1013911652 6:115282672-115282694 GGATGAAGCCACCCTCCCTCTGG + Intergenic
1015818736 6:137237557-137237579 GGGTGAGGGAAGCCTGCCATTGG + Intergenic
1016278332 6:142381036-142381058 GGATGAAGAAACCATGCCTCTGG + Intronic
1018928343 6:168222577-168222599 GGGTGAGGGGCCCCTGCCACTGG + Intergenic
1024365046 7:48510585-48510607 GGGTGAAGCTACCCAGCCTGTGG - Intronic
1024683238 7:51716684-51716706 GGCTCAAGCAATCCTCCCACTGG - Intergenic
1040306007 8:46212195-46212217 GGGTGAAGCAATGATACCACTGG + Intergenic
1040419298 8:47224215-47224237 GGGTAAAGAATGCCTGCCACTGG + Intergenic
1040512105 8:48105063-48105085 GGGTGAAGCCACCCTTCCCAGGG + Intergenic
1042574731 8:70205465-70205487 TGGTGAAGCCCCCTTGCCACTGG + Intronic
1043639926 8:82439256-82439278 AGGTGAAACAACCCAGGCACAGG - Intergenic
1050584480 9:7096416-7096438 GGGTGAAACAAGCCAGCCTCTGG - Intergenic
1052704953 9:31983398-31983420 GGATGAAGCTACCCTGTCACTGG - Intergenic
1055018448 9:71644189-71644211 GGGTGAAGCAATCCTCCCACTGG - Intergenic
1060794271 9:126503887-126503909 GGGAGCAGCACCCCTGCCCCCGG + Exonic
1196247447 X:113415997-113416019 GGGTGAGGCACCTCTGCCTCTGG + Intergenic
1196564537 X:117189382-117189404 GGGTGAAGCTTCCCTGCCTTTGG + Intergenic
1197720194 X:129739763-129739785 GGGTGATGCAAGCCTGGCAAGGG + Intronic
1198471458 X:136950774-136950796 GGGAGATGCAATCCTGACACAGG + Intergenic
1199316108 X:146379747-146379769 GGGTGAAGCTTCTCTGACACTGG + Intergenic