ID: 1152068549

View in Genome Browser
Species Human (GRCh38)
Location 17:78124334-78124356
Sequence ATCGTGCTGGGGTTCCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152068549_1152068565 9 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068565 17:78124366-78124388 GGGTCATTGAGGGGGAGGCGGGG 0: 1
1: 0
2: 1
3: 20
4: 253
1152068549_1152068559 0 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068559 17:78124357-78124379 GAGCATCCAGGGTCATTGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1152068549_1152068558 -1 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068558 17:78124356-78124378 TGAGCATCCAGGGTCATTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 125
1152068549_1152068561 4 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068561 17:78124361-78124383 ATCCAGGGTCATTGAGGGGGAGG 0: 1
1: 1
2: 3
3: 12
4: 177
1152068549_1152068563 7 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068563 17:78124364-78124386 CAGGGTCATTGAGGGGGAGGCGG 0: 1
1: 0
2: 0
3: 43
4: 460
1152068549_1152068568 29 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068568 17:78124386-78124408 GGGAGCTGGCTGTGGCCACCTGG 0: 1
1: 0
2: 3
3: 52
4: 473
1152068549_1152068567 21 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068567 17:78124378-78124400 GGGAGGCGGGGAGCTGGCTGTGG 0: 1
1: 0
2: 9
3: 122
4: 1131
1152068549_1152068557 -2 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068557 17:78124355-78124377 ATGAGCATCCAGGGTCATTGAGG 0: 1
1: 0
2: 1
3: 16
4: 124
1152068549_1152068566 15 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068566 17:78124372-78124394 TTGAGGGGGAGGCGGGGAGCTGG 0: 1
1: 0
2: 5
3: 82
4: 908
1152068549_1152068560 1 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068560 17:78124358-78124380 AGCATCCAGGGTCATTGAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 167
1152068549_1152068564 8 Left 1152068549 17:78124334-78124356 CCCCATGGGAACCCCAGCACGAT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1152068564 17:78124365-78124387 AGGGTCATTGAGGGGGAGGCGGG 0: 1
1: 0
2: 1
3: 22
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152068549 Original CRISPR ATCGTGCTGGGGTTCCCATG GGG (reversed) Intronic