ID: 1152069083

View in Genome Browser
Species Human (GRCh38)
Location 17:78126270-78126292
Sequence CACTCACCAATGGTGCGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152069077_1152069083 -7 Left 1152069077 17:78126254-78126276 CCGAGGCTGAGGGTCCCACTCAC 0: 1
1: 1
2: 3
3: 13
4: 202
Right 1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1152069073_1152069083 5 Left 1152069073 17:78126242-78126264 CCGGGGCCGAGGCCGAGGCTGAG 0: 1
1: 3
2: 16
3: 88
4: 581
Right 1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1152069065_1152069083 29 Left 1152069065 17:78126218-78126240 CCAGGGACTGGGGTCAACTCGGG 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1152069076_1152069083 -1 Left 1152069076 17:78126248-78126270 CCGAGGCCGAGGCTGAGGGTCCC 0: 1
1: 1
2: 3
3: 27
4: 257
Right 1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1152069063_1152069083 30 Left 1152069063 17:78126217-78126239 CCCAGGGACTGGGGTCAACTCGG 0: 1
1: 0
2: 0
3: 1
4: 123
Right 1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152069083 Original CRISPR CACTCACCAATGGTGCGGCT GGG Exonic
902239721 1:15080458-15080480 CACTCACCACTGTGGCTGCTGGG - Intronic
919233830 1:194811306-194811328 CACTCATCAAGGGTGGGGCCAGG - Intergenic
1073068642 10:100779568-100779590 CTCTTACCAATGGTGTGGCCAGG - Exonic
1076777350 10:132705091-132705113 CTCCCACCAACGGTGCAGCTGGG - Intronic
1078729349 11:13961737-13961759 CACTCACCCATTGTGAAGCTTGG - Intergenic
1079090411 11:17476622-17476644 CACTCACCAATGAAGAGGATGGG + Exonic
1082636394 11:55599575-55599597 CAAACAACAATGGTGCAGCTAGG - Intergenic
1087120326 11:94567590-94567612 TACACACCAATGGCGAGGCTTGG - Exonic
1100437823 12:94588157-94588179 CAGTCACCACCAGTGCGGCTTGG + Intronic
1103165319 12:118765388-118765410 CACGCACCAGTGATGAGGCTGGG - Intergenic
1103592852 12:122004481-122004503 CACTCACCAGTGTGGTGGCTTGG + Intergenic
1104331721 12:127853197-127853219 CCCTCACAAAGGGTGCTGCTTGG - Intergenic
1106533130 13:30613794-30613816 CCCTAGCCAATGGTACGGCTGGG - Intronic
1106629772 13:31459018-31459040 CACTCACAAATGGTGTGGCATGG - Intergenic
1109809181 13:67488008-67488030 CACACTCAAATGGTGCTGCTAGG + Intergenic
1114512934 14:23277421-23277443 CACTCACCAGTCATGTGGCTTGG - Intronic
1114833508 14:26175110-26175132 CACACAACATTGGTGCGGCTTGG - Intergenic
1120289378 14:82547420-82547442 CACTCACCACTGGAGCACCTGGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121607814 14:95254074-95254096 CACACAACAGTGGTGCTGCTAGG - Intronic
1122544491 14:102514667-102514689 CACCCACCAGTGGTGGGACTGGG + Intergenic
1131003254 15:88955131-88955153 AACTAACCAATGGTCCGGCCTGG - Intergenic
1131605250 15:93896680-93896702 CACTCACCAATAGTGTGATTTGG + Intergenic
1133805446 16:9123141-9123163 CATTCACAAAAGGTGTGGCTGGG - Intergenic
1134910889 16:18025360-18025382 TTCTCACCAGTGGTGCAGCTGGG + Intergenic
1137731678 16:50694433-50694455 CACTCAGCCATGGGGCTGCTGGG + Intronic
1140822530 16:78676471-78676493 CAGTCACCAAAGGTGGGGGTGGG - Intronic
1143345222 17:6244304-6244326 CTCTCACCAATTGTGCTGATGGG + Intergenic
1148034094 17:44645212-44645234 CACTCTCAGATGGTGCAGCTGGG - Intergenic
1152064078 17:78100507-78100529 CAGTCACAACTGGAGCGGCTGGG + Intronic
1152069083 17:78126270-78126292 CACTCACCAATGGTGCGGCTGGG + Exonic
1161454268 19:4362322-4362344 CACTCACGCATGCTCCGGCTAGG + Exonic
1166919292 19:46217996-46218018 CAACCACCAGTGGTGCGGATGGG - Intergenic
925072771 2:984056-984078 CCCTCAGCAATGGGGCAGCTTGG - Intronic
927979843 2:27368098-27368120 CACCCAGCCATGGTGCGACTCGG - Exonic
931993988 2:67822544-67822566 CACTAGCCAAGGGTGCAGCTGGG - Intergenic
932480565 2:72036677-72036699 CAGTCACCCATGGTGGGGCGGGG - Intergenic
936042500 2:109160647-109160669 AACTCAACAATGGTGGGGCTGGG + Intronic
1168878777 20:1188675-1188697 CACACACAAATGGTGGGGGTAGG + Intronic
1170201013 20:13744109-13744131 CTCTCATCAATGGTCCGGCATGG - Intronic
1174312219 20:49666355-49666377 CACTCAGCAAAGGTGCTGCTTGG + Intronic
1179376794 21:40856841-40856863 CCCTCACTAAAGGTGCTGCTAGG - Intergenic
1182397801 22:30048961-30048983 CATTTATCAATGGTGCAGCTCGG - Intergenic
952339362 3:32432450-32432472 CAATAACCAGTGGTGAGGCTGGG + Intronic
962454868 3:135555779-135555801 GACTCATCAATGGTGCTGCCAGG - Intergenic
962624338 3:137210525-137210547 CACTCACTCAAGGTGGGGCTAGG - Intergenic
962973436 3:140425641-140425663 CACTCACCAATGGGCAGGGTGGG + Intronic
966531814 3:180989593-180989615 CACTCACCATGGCTCCGGCTGGG + Exonic
966709446 3:182955874-182955896 CACAAAACCATGGTGCGGCTGGG - Intronic
969621599 4:8281545-8281567 CACACACCAGGGGTTCGGCTGGG - Intronic
977343681 4:95791824-95791846 CACCCACCAATGCTGAGGCTTGG + Intergenic
982315019 4:154023549-154023571 CACTCAGCAATGATGCGGAATGG + Intergenic
988239695 5:28593779-28593801 AACTCATCAATGGTGATGCTGGG - Intergenic
991492658 5:67197948-67197970 CACTCTCTAATTGTGTGGCTTGG - Intergenic
996664966 5:126048557-126048579 AACTCACCAAAGGTGGGGTTTGG - Intergenic
999462886 5:151772080-151772102 CTCTCACAAGTGCTGCGGCTCGG - Intronic
1007394328 6:41569073-41569095 CACTCACCAATGACCAGGCTGGG - Intronic
1008571228 6:52818959-52818981 CACTCACCAAGTGTGCAGCGTGG - Intergenic
1008577198 6:52872583-52872605 CACTCACCAAGTGTGCAGCGTGG - Intronic
1011296800 6:85835053-85835075 CACCCACCATTGCTGAGGCTTGG - Intergenic
1019200285 6:170308181-170308203 CACTCACTAATGATGGAGCTGGG - Intronic
1030221459 7:107103473-107103495 CTGTAACCAATGGTGCTGCTGGG - Intronic
1035311266 7:157970522-157970544 TCCTCACCATTGGTGCGGGTGGG + Intronic
1036808660 8:11852603-11852625 CACTCACCTCTGGGGTGGCTTGG + Exonic
1042848054 8:73187861-73187883 CACTCCTCAGTGGTGCAGCTTGG - Intergenic
1045899789 8:107263527-107263549 CACTTACCAATGATGCTTCTTGG - Intronic
1048826782 8:138435382-138435404 CCCTAACCAATGGTGAAGCTTGG + Intronic
1188104471 X:26133028-26133050 CACTCACCAGGGCTGGGGCTAGG + Intergenic
1193160121 X:78218156-78218178 CACCCAACAATGGTCCTGCTGGG + Intergenic
1200097469 X:153670911-153670933 CACTCACCAAAGGTGCCGCAAGG + Exonic