ID: 1152070637

View in Genome Browser
Species Human (GRCh38)
Location 17:78132161-78132183
Sequence GTGCCTGCGGGCGGAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152070637_1152070645 -10 Left 1152070637 17:78132161-78132183 CCACCCCTTCCGCCCGCAGGCAC 0: 1
1: 0
2: 1
3: 14
4: 309
Right 1152070645 17:78132174-78132196 CCGCAGGCACCGCAAACCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1152070637_1152070651 22 Left 1152070637 17:78132161-78132183 CCACCCCTTCCGCCCGCAGGCAC 0: 1
1: 0
2: 1
3: 14
4: 309
Right 1152070651 17:78132206-78132228 CACCCCCAGGTGACTGTCAGCGG 0: 1
1: 0
2: 1
3: 22
4: 302
1152070637_1152070648 9 Left 1152070637 17:78132161-78132183 CCACCCCTTCCGCCCGCAGGCAC 0: 1
1: 0
2: 1
3: 14
4: 309
Right 1152070648 17:78132193-78132215 CGGGCCCACGCAGCACCCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152070637 Original CRISPR GTGCCTGCGGGCGGAAGGGG TGG (reversed) Intronic
900100605 1:960563-960585 GCGGCTGCGGGCGGGAGCGGCGG + Intergenic
900102848 1:970210-970232 GTGGATGCGAGCGGAGGGGGTGG + Intronic
900119041 1:1040899-1040921 GTGCCTGGGGCGGGGAGGGGCGG + Intronic
900226512 1:1535794-1535816 GTGCCTGGGGGCGGCAGGGCGGG + Exonic
900309817 1:2028329-2028351 GTGGGCGCGCGCGGAAGGGGCGG - Intronic
900309824 1:2028351-2028373 GTGGGCGCGCGCGGAAGGGGCGG - Intronic
900601833 1:3506051-3506073 GTGGCAGCGGGTGGAAGGGATGG - Intronic
901055137 1:6445786-6445808 GTGCCTGGGGGCGGGGGTGGCGG - Exonic
902479232 1:16702828-16702850 GTGCCTGGGGGCGGGGGTGGCGG + Intergenic
902919548 1:19657792-19657814 TTGCCTGGTGGGGGAAGGGGAGG + Exonic
904773438 1:32893505-32893527 TGGCCTGGGGGCGGGAGGGGAGG - Exonic
906085990 1:43135288-43135310 GTGCCTGTTGGAGGAGGGGGAGG - Intergenic
906208379 1:43998967-43998989 GGGCCTGGCGGGGGAAGGGGGGG + Intronic
906398948 1:45490879-45490901 GTGCCTGCGCGGGCAAGAGGAGG + Exonic
907384675 1:54118334-54118356 GTTCCTGCAGGGGGAGGGGGAGG - Intergenic
907920043 1:58903742-58903764 GTGCCCGCGGGAGGAGCGGGTGG + Intergenic
909169979 1:72282749-72282771 GTGCCAGGGGGAGGGAGGGGAGG - Intergenic
909622369 1:77683035-77683057 GTGTGCGCGGGCGAAAGGGGGGG - Intronic
911121286 1:94299747-94299769 GAGCCAGAGGGAGGAAGGGGAGG + Intergenic
911524160 1:98964310-98964332 GTGCCTGTGGGAGGCAGGAGGGG - Intronic
915246373 1:154558709-154558731 GGGCCAGCGAGCGGAGGGGGGGG - Intronic
915340778 1:155175567-155175589 GGGGCTGCGGGTGGAAGGGGTGG - Exonic
915912755 1:159924689-159924711 GTGGCCGCGGGCGGACGGGCGGG - Intronic
921576538 1:216841680-216841702 GGCCCTGCAGGCTGAAGGGGAGG - Intronic
924850577 1:247825537-247825559 GTGCTGGCGGGCGGAAGTGCTGG + Intergenic
924850585 1:247825569-247825591 GTGCTGGCGGGCGGAAGTGCTGG + Intergenic
924850589 1:247825585-247825607 GTGCTGGCGGGCGGAAGTGCTGG + Intergenic
1063161759 10:3423610-3423632 GTGCATGCGGGGCGAAGGGAGGG + Intergenic
1063449993 10:6144895-6144917 GCGCCTGCGGGCGGCGGGGCGGG - Intergenic
1064701273 10:18023989-18024011 CAGCCTGAGGGCAGAAGGGGTGG + Intronic
1067375880 10:45727365-45727387 GAGCCTGAGGGCGGCAGGGACGG - Intronic
1067569464 10:47360807-47360829 GTGCCTGCAGGGAGAATGGGAGG - Intergenic
1067841052 10:49679766-49679788 GGCCCTGCAGGCGGAAGGTGTGG - Exonic
1067883584 10:50068053-50068075 GAGCCTGAGGGCGGCAGGGACGG - Intronic
1069545094 10:69321910-69321932 GTGCCTGTAGGAGGAAAGGGAGG + Intronic
1069593492 10:69656105-69656127 GAGCCTGCGGGGGGCAGGTGAGG - Intergenic
1069686302 10:70321333-70321355 GGGCCTGCTGGAGGAAGGAGGGG - Intronic
1069853429 10:71425167-71425189 GTGGGTGAGGGTGGAAGGGGAGG + Intronic
1069915188 10:71782859-71782881 GAGCCTGGGAGCGGAAGGGCTGG + Intronic
1076215086 10:128686974-128686996 GTGCCTGTGGAAGGAAGGGCAGG + Intergenic
1077043675 11:535308-535330 GGGCCGGCGGGCGTAAGCGGCGG - Intronic
1077050960 11:566592-566614 GTTCCGGCGGGGGGAAGGCGGGG + Intergenic
1077153670 11:1082188-1082210 GTGCCTGCGGGTGGGAGGCCTGG + Intergenic
1077309835 11:1883400-1883422 GGGCCTGTGGGTGGAAAGGGAGG - Exonic
1077385832 11:2269123-2269145 GAGGCTGCGGGGGGAAGGTGGGG + Exonic
1078109710 11:8382574-8382596 GTGCCTGTGGGCGGGAGGCGTGG + Intergenic
1078768495 11:14323530-14323552 GTGCCGGTGGGGGGAAGAGGGGG - Intronic
1079314846 11:19398806-19398828 GTGTCTGTGGGGGGAAGGAGGGG - Intronic
1079674014 11:23202552-23202574 GTCCCTTGGGGGGGAAGGGGTGG + Intergenic
1082785808 11:57315808-57315830 GTGCCTGATAGCAGAAGGGGAGG - Intronic
1083271644 11:61575891-61575913 GAGCCCACGGGTGGAAGGGGAGG - Intronic
1083933280 11:65857583-65857605 ATGCCTGCGCCCGGGAGGGGCGG - Intronic
1083945005 11:65918887-65918909 GTGACTGCGGGCGGCGGGAGGGG - Intronic
1083961492 11:66017171-66017193 CTGCCTGCGGGTGGGCGGGGGGG + Exonic
1088462064 11:110092909-110092931 GTGGCTGCGGGCGGGCGGGCGGG + Intergenic
1089020997 11:115214777-115214799 AGGCCTGCAGGGGGAAGGGGAGG + Exonic
1089479350 11:118791978-118792000 GCGCCTGCGGGTGGTATGGGGGG + Intergenic
1089962564 11:122628848-122628870 GTGGCTGCTGTTGGAAGGGGAGG + Intergenic
1091744792 12:2984167-2984189 GTGCCTGTGTGCGGAAGGTATGG + Intronic
1091778477 12:3199729-3199751 GTGCGTGCGCGCCGAGGGGGCGG + Intronic
1096658220 12:53104926-53104948 AGGCCTGCGGGGGGAAGGGCAGG - Intronic
1096738776 12:53676829-53676851 GAGCATGGGGGCGGGAGGGGAGG - Intronic
1096781137 12:53992787-53992809 CTGCCTGCGGGCGGAGTTGGGGG + Intronic
1100565598 12:95790843-95790865 GGGCGGGCGGGAGGAAGGGGTGG - Intronic
1102683042 12:114703380-114703402 GAGCCTGCAGGGGGCAGGGGAGG - Intergenic
1104405362 12:128512043-128512065 GTGCCTGTGGCCGACAGGGGCGG - Intronic
1104903051 12:132199366-132199388 GTGCCCGCGGGAGGAGGAGGGGG + Intronic
1104976819 12:132555870-132555892 GTGCCTGCGGGGAGAAAGGTGGG - Intronic
1105005221 12:132717292-132717314 GTGTTTGCGGGCGGAGGAGGGGG + Intronic
1105005229 12:132717314-132717336 GTGTTTGCGGGCGGAGGAGGGGG + Intronic
1105005243 12:132717358-132717380 GTGTTTGCGGGCGGAGGAGGGGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106735662 13:32586257-32586279 TTGCGTGCGCGCGGACGGGGCGG + Intergenic
1106735672 13:32586294-32586316 GTGCGCGCGCGCGGACGGGGCGG + Intergenic
1107145856 13:37059710-37059732 GGGAAGGCGGGCGGAAGGGGAGG + Intronic
1107162037 13:37241486-37241508 CTGCCTGTGGGTGGAAGGTGGGG + Intergenic
1112091662 13:96090354-96090376 GTGCCCGCGGCCGGCCGGGGCGG + Intergenic
1112426235 13:99304003-99304025 GTGGCTGCGGGCAGAAGGGCGGG - Intronic
1112652718 13:101416342-101416364 GTGCCCGCGGGCGGCGGCGGCGG + Exonic
1113625912 13:111846268-111846290 GGGCCTTCGGCCGGAAGGGCCGG + Intergenic
1114522244 14:23347003-23347025 GGGCCTGCGGGCTGGAGGAGGGG - Intronic
1114604892 14:23988659-23988681 GTTCCTGCGGGGGCCAGGGGAGG + Intronic
1114610340 14:24036206-24036228 GTTCCTGCGGGGGCCAGGGGAGG + Intergenic
1115120109 14:29928004-29928026 GGAACTGCGGGCGGAGGGGGCGG - Intronic
1115772770 14:36683505-36683527 GTGGCTTCTGGCTGAAGGGGAGG - Intronic
1117353407 14:54902275-54902297 GAGCGTGCGGGCGGCGGGGGCGG - Intronic
1117803984 14:59470944-59470966 GTGGCTGGGGGCGGGGGGGGGGG + Intronic
1119236817 14:73026819-73026841 CTGCCCTCGGGAGGAAGGGGGGG - Intronic
1121336177 14:93078778-93078800 GTCCCTGCGGGGGGAGGGGCAGG - Intronic
1122276466 14:100593239-100593261 GTGCCTGTGGGTGGTCGGGGTGG - Intergenic
1122905737 14:104800732-104800754 GGGCCGGCGGGCGGGCGGGGCGG - Intronic
1123042711 14:105496924-105496946 GGGACTGCAGGCGGACGGGGAGG - Intronic
1124149695 15:27166604-27166626 GTGCCTGCTGGTGTAGGGGGTGG - Intronic
1124628768 15:31325898-31325920 GGGCCTGCGGCGGGATGGGGAGG + Intergenic
1126766892 15:52019014-52019036 TTGCCTGCGGGCGGGCAGGGAGG - Intronic
1127995561 15:64151667-64151689 GGGCCTGCGGACCGAGGGGGCGG + Intergenic
1128455081 15:67827569-67827591 TTGCGTGCGGGCGGCGGGGGCGG - Intronic
1128657676 15:69474409-69474431 GTGCCTGAGGGAGGGAGGTGGGG + Intergenic
1129118540 15:73380470-73380492 GGGACTGAAGGCGGAAGGGGCGG - Intergenic
1129467481 15:75732045-75732067 GGGCCTGCGGGTGGTGGGGGTGG + Intergenic
1130519065 15:84648423-84648445 GTGCCTGTGTGCTGAGGGGGTGG + Intronic
1130938537 15:88489626-88489648 ATGCCTGTGGGAGGAAGAGGAGG - Intergenic
1130963247 15:88678949-88678971 GTGCCTGCGGGTGGCAGGGGAGG - Intergenic
1130969069 15:88718267-88718289 GTGCCTGGGGTGGGATGGGGTGG + Intergenic
1131177577 15:90219704-90219726 GGGCCTGGGTGTGGAAGGGGGGG + Intronic
1131493452 15:92882649-92882671 GGGCCTGCGGGCGGGAGGCGGGG + Intergenic
1132105404 15:99059329-99059351 GGGCCCGCGGGAGGAGGGGGAGG - Intergenic
1132314856 15:100881988-100882010 GTGCCTGCCGAGGGAAGGAGCGG + Intronic
1132591469 16:728097-728119 GTCCCTGCGGGCGGGCGGGCGGG - Exonic
1132693192 16:1190759-1190781 GTGGGTGCTGGGGGAAGGGGAGG + Intronic
1132743826 16:1428645-1428667 GGGCCTGCGGAGGGAAGGGCGGG - Intergenic
1133213182 16:4274061-4274083 GGGCCTGGGGCCGGAAGGTGCGG - Intergenic
1136247039 16:28982081-28982103 GGGCCTGCGGGTGGCAGGGCTGG + Intronic
1139655490 16:68384742-68384764 GTGCTTGCGGGGGGAGTGGGGGG - Intronic
1139949531 16:70662394-70662416 GTGGCAGCGGGGGCAAGGGGAGG - Exonic
1141333208 16:83131191-83131213 GTGTCTGTGGGCGGGGGGGGGGG - Intronic
1141463820 16:84194300-84194322 GAGCCTGCTGGAGGAAGGGAAGG + Intronic
1141608542 16:85169140-85169162 GCGGCGGCGGGCGGGAGGGGCGG - Intergenic
1141631802 16:85291817-85291839 GTGCTGGCGGGGGGATGGGGAGG - Intergenic
1141682608 16:85553310-85553332 CTGCCGGCGGGTGCAAGGGGAGG + Intergenic
1142120427 16:88383926-88383948 GTGGCGGCGGCCGGAAGGGAAGG + Intergenic
1142304170 16:89276221-89276243 GCACCTGCAGGCGGAAGGGGTGG + Intronic
1142586875 17:979483-979505 GCGCCTGCGGGGGGACGCGGCGG - Exonic
1142849126 17:2695851-2695873 GAGCCTGCGGGAGGAGGAGGAGG + Intronic
1144172833 17:12676226-12676248 GTGCGTGCGCGCGCAGGGGGAGG - Intronic
1144889906 17:18488717-18488739 TCCCCTGCGGGTGGAAGGGGAGG + Intronic
1145142308 17:20455600-20455622 TCCCCTGCGGGTGGAAGGGGAGG - Intronic
1145868834 17:28257309-28257331 ATGCCTGGGGAGGGAAGGGGAGG + Intergenic
1147341430 17:39755024-39755046 GTGCCTGGGAGAGGAAAGGGAGG - Intergenic
1147648830 17:42050534-42050556 GTGAGTGCGAGCGGACGGGGCGG - Intronic
1147663333 17:42129343-42129365 GTGCCTGGAGGTGGTAGGGGTGG - Intronic
1149532788 17:57408769-57408791 GTGCCAGTGGGTGCAAGGGGTGG + Intronic
1150388365 17:64777201-64777223 GGGCCTGGGGGGGGAGGGGGTGG + Intergenic
1151786063 17:76275696-76275718 GGGCCTGGGAGCCGAAGGGGGGG - Intronic
1152070637 17:78132161-78132183 GTGCCTGCGGGCGGAAGGGGTGG - Intronic
1152175371 17:78783281-78783303 GTGACTGCAGGGGGAAAGGGGGG - Intergenic
1152199657 17:78938018-78938040 GTGCCTGCTGGTGGAAAAGGGGG - Intergenic
1152222337 17:79075459-79075481 ATGCCGGCTGGTGGAAGGGGTGG + Intronic
1152364967 17:79850209-79850231 GTGGCTGAGGGCGGAGGAGGAGG + Intergenic
1152401202 17:80067307-80067329 GTGACTGCGGGCCGAGGAGGAGG - Intronic
1152583361 17:81178716-81178738 GGGGCTGCGGGCGGTGGGGGTGG - Intergenic
1152697160 17:81803211-81803233 ATGGCTGGGGGTGGAAGGGGAGG + Intergenic
1160163242 18:76491339-76491361 GGGGCTGCGGGGGGAAGGGCAGG - Intronic
1160769170 19:822511-822533 GTGAGTGCGGGGGGAAGGGAGGG - Intergenic
1161239374 19:3213463-3213485 GGGCCTCCTGGGGGAAGGGGAGG + Intergenic
1161455378 19:4367181-4367203 GGGCCTGCAGGGGGAGGGGGAGG + Intronic
1161578339 19:5067087-5067109 GAGCCTTCGGGAGGGAGGGGTGG - Intronic
1162025256 19:7890181-7890203 GTTCCTGCTGGGGGAAGGGTGGG - Intronic
1162432366 19:10636643-10636665 GTACCTGCGGGCCGAGGGAGTGG - Exonic
1162463133 19:10825038-10825060 CTGCCTGCAAGCGGGAGGGGAGG - Exonic
1162465248 19:10835831-10835853 GTGTGTGGGAGCGGAAGGGGAGG - Intronic
1162751711 19:12833726-12833748 GCGCTGGCGGGGGGAAGGGGCGG - Intronic
1162893071 19:13747959-13747981 GTGCCGGCGGGCGGAGGAGCGGG + Intronic
1162944213 19:14032322-14032344 GGGTGTGCAGGCGGAAGGGGGGG + Intronic
1163123992 19:15234312-15234334 CTGCTTCCGGGAGGAAGGGGAGG - Intergenic
1163125646 19:15242992-15243014 TGGCCTGGGGGCGGATGGGGGGG + Exonic
1163364790 19:16869826-16869848 GGGGCTGGGGGCGGCAGGGGTGG - Exonic
1164162132 19:22634204-22634226 GGGCCTGAGGGCGGGGGGGGGGG + Intergenic
1164201682 19:23024354-23024376 CTGCCTACGGGCGGGGGGGGGGG - Intergenic
1164647775 19:29872370-29872392 CTGCCTACGGGCGGGAGGGCTGG - Intergenic
1165944906 19:39436126-39436148 GGCTCTGTGGGCGGAAGGGGCGG + Intergenic
1166094526 19:40530676-40530698 GTGGCCGCGGGAGGGAGGGGCGG + Intronic
1166373708 19:42315681-42315703 GTTCCTGGGGGAGGAGGGGGTGG + Intronic
1166502933 19:43354393-43354415 GTGCCTGCGGGAGGGTCGGGAGG + Intronic
1166781715 19:45346636-45346658 GTGGCTGCGGGAGGAACTGGAGG + Exonic
1166995326 19:46717185-46717207 GGGGCCGGGGGCGGAAGGGGAGG + Intergenic
1167328000 19:48836884-48836906 GGGTCTGAGGGAGGAAGGGGTGG - Intergenic
1167435062 19:49474472-49474494 AAGCCTGGGGGAGGAAGGGGCGG + Intronic
1167613104 19:50516842-50516864 GTGGGTGGGGGCGGAAGGAGAGG - Intergenic
1168107744 19:54174583-54174605 GGGTCTGAGGGAGGAAGGGGTGG - Intronic
1168292355 19:55362762-55362784 GTGGCTGCTGGAGGAAGGAGTGG - Intronic
1168324491 19:55531011-55531033 GGGCCTCCGGGGGGTAGGGGAGG + Intronic
1168538657 19:57192234-57192256 GGGCCTGAGGGGGGAAGGGGAGG + Intronic
1202713271 1_KI270714v1_random:28734-28756 GTGCCTGGGGGCGGGGGTGGCGG + Intergenic
925362140 2:3286913-3286935 GTGCCAGCCGGCAGAGGGGGCGG + Intronic
925362151 2:3286951-3286973 GTGCCAGCCGGCAGAGGGGGCGG + Intronic
925755578 2:7128454-7128476 CTGCCTGGGGCAGGAAGGGGAGG - Intergenic
927685166 2:25165682-25165704 GTGCCTGTGGGCAGAAGCTGAGG + Intronic
927900102 2:26812875-26812897 GTGGGTGCTGGAGGAAGGGGAGG - Intergenic
929355242 2:41015781-41015803 GAGCCTGTTGGAGGAAGGGGAGG - Intergenic
930518580 2:52435730-52435752 GTGCCTGAGGGAGCAGGGGGTGG - Intergenic
931242032 2:60462050-60462072 GCGCCTGGGGGCGGAAGAGATGG - Exonic
932217564 2:69976697-69976719 GTGCCTGGAGGGGGAAAGGGAGG - Intergenic
932893191 2:75613340-75613362 GGGCCTGCGGGGGGGGGGGGGGG + Intergenic
933901390 2:86852911-86852933 GTGCCTGGGGAAGGAAGGAGGGG + Intronic
934766954 2:96885078-96885100 GTGCCTGCTAGGGCAAGGGGTGG + Intronic
934854890 2:97723631-97723653 TTGCCTTCGGGAGGACGGGGTGG + Intronic
935240252 2:101171626-101171648 GTGGCTGGGGGGGGCAGGGGTGG - Intronic
935779160 2:106496326-106496348 GTGCCTGGGGAAGGAAGGAGGGG - Intergenic
938292934 2:130159933-130159955 GTGACTGCCGGCGGCAGGGGCGG - Intronic
938296333 2:130181855-130181877 GGGCGGGCGGGGGGAAGGGGGGG - Exonic
938463621 2:131513031-131513053 GTGACTGCCGGGGGCAGGGGTGG + Intergenic
939912926 2:148005392-148005414 GGGCCTGCTGGGGGATGGGGGGG + Intronic
942147919 2:173044263-173044285 GCGCCGGGGGGCGGGAGGGGGGG + Intronic
943771359 2:191721282-191721304 CTGCCTGGGGGAGGTAGGGGTGG - Intergenic
945696048 2:213105575-213105597 GTGTGTGGGGGGGGAAGGGGGGG + Intronic
947791504 2:232871791-232871813 GTCCGTGTGGGCCGAAGGGGAGG + Intronic
947932680 2:233976533-233976555 GGGGCTGCGGGAGGAAGGGTGGG + Intronic
948229092 2:236336651-236336673 GTGCTTGCTGGCAGTAGGGGTGG - Intronic
948468652 2:238164004-238164026 GTGCCGGCGCGCGGGAGGGCGGG + Intronic
948897479 2:240934114-240934136 GTGCCTCCGGGGGGACGGGAGGG - Intronic
948953930 2:241272708-241272730 GGGCGGGCGGGCGGACGGGGCGG - Intronic
949038408 2:241832054-241832076 GGGCCTGTGGGCGGGAGGGGAGG + Intergenic
949082959 2:242120002-242120024 GTAGCTGCGGGGGGGAGGGGGGG + Intergenic
1169455739 20:5750612-5750634 GTGTGTTGGGGCGGAAGGGGCGG - Intronic
1172225877 20:33304909-33304931 GTGCCTGAGGGCACAGGGGGTGG + Intronic
1173243339 20:41317274-41317296 GGGGCTCCGGGGGGAAGGGGCGG + Intronic
1173847896 20:46199556-46199578 GTACCTGCGGGGGGCAGGGCAGG + Exonic
1173905178 20:46622484-46622506 GTGCCTGCTGGACAAAGGGGAGG - Intronic
1175180530 20:57143346-57143368 GTGCGTGTGGGAGGCAGGGGAGG - Intergenic
1175715600 20:61252727-61252749 CTGCCTGCGGTCGGCAGGAGCGG + Intronic
1176023880 20:62976097-62976119 GTGCCTGCTGGGGGAAGGTTCGG - Intergenic
1176093893 20:63330825-63330847 GAGCCTGCAGGTGGAAGGAGAGG + Exonic
1176115167 20:63429052-63429074 GTGGCTGTGGGCGGCAGGGCAGG - Intronic
1177500899 21:21953242-21953264 GTGCCTGCAGGAGTCAGGGGTGG - Intergenic
1179209296 21:39312765-39312787 GTCCCCGCGAGGGGAAGGGGCGG + Intronic
1179487962 21:41722844-41722866 GTGTGTGCGGGGGGAAGTGGGGG - Intergenic
1179998106 21:44983162-44983184 GTGGCTGCCGGCGGGCGGGGAGG + Intergenic
1180232630 21:46436474-46436496 GTGCCAGCGGGGGGGGGGGGGGG - Intronic
1181635073 22:24170753-24170775 GTGCATGGGGGCGGGGGGGGGGG - Intronic
1182355243 22:29719908-29719930 GGGCCGGCGGCGGGAAGGGGCGG + Intergenic
1182551800 22:31104736-31104758 GTTGCTGCGGGCGGGTGGGGTGG - Intronic
1183469054 22:37996207-37996229 CTGCCTGCTGGGGGAAGGGGTGG - Intronic
1183606057 22:38867198-38867220 GCGCCTGCGGGCAGAGGGAGGGG + Exonic
1183986913 22:41575158-41575180 GTGTCTGCGGCAGGGAGGGGAGG - Exonic
1184176471 22:42792182-42792204 GTGCCTACGGGAGGAGGGGGAGG + Intergenic
1184523184 22:45007674-45007696 GGGGCTGCGCGGGGAAGGGGCGG + Intronic
1184523192 22:45007699-45007721 GTGCGAGCGCGGGGAAGGGGCGG + Intronic
1184978901 22:48082158-48082180 TCCCCTGCGGGAGGAAGGGGCGG - Intergenic
1185067990 22:48641560-48641582 GGGCGTGCAGGGGGAAGGGGAGG - Intronic
1185285710 22:49999254-49999276 ATGCCAACGGGCGGAAGGGTGGG - Intronic
949575106 3:5331339-5331361 GTGCCTGCGGCCGGGAGCGGTGG - Intergenic
950542737 3:13621927-13621949 GTGACGGCGGGCGGCAGGCGGGG - Intronic
950952340 3:17013710-17013732 GGGCATGCGGGCAGAGGGGGTGG - Intronic
954314709 3:49794890-49794912 GTGCTTGCAGTGGGAAGGGGTGG - Intronic
954708859 3:52495221-52495243 CAGCCTGCAGGCGGAAGGGAAGG - Intergenic
957837527 3:85617187-85617209 GTGAGTGCTGTCGGAAGGGGTGG - Intronic
960593976 3:119391591-119391613 GTGACGGCGGGGGGGAGGGGGGG - Intronic
960982560 3:123244279-123244301 GTGGGTGGGGGCGGAAGTGGGGG + Intronic
961327515 3:126118095-126118117 GAGCCTGTGGGCGGGAGGGAGGG + Exonic
962357908 3:134710578-134710600 GTGCCTGGGGTGGGAAGGAGGGG - Intronic
963511113 3:146250838-146250860 GTGCCTGCGGGCAGGCGCGGAGG - Intronic
963745814 3:149124405-149124427 GTCCCTGCAGGGGGAAGGAGTGG - Intergenic
968129593 3:196185067-196185089 GTGCTGGCGGGCGGGAGGTGAGG - Intergenic
968606128 4:1536519-1536541 GTGGCAGCGGGCGGGGGGGGCGG + Intergenic
969271355 4:6105440-6105462 GTGCCCGCGGGCGGGGGAGGGGG + Intronic
969613978 4:8241777-8241799 GGGCCGGGGGCCGGAAGGGGAGG - Intronic
970407672 4:15778848-15778870 GTGCCCGCGGGAGGCGGGGGGGG + Intronic
974449624 4:62036379-62036401 GTGCCTGCGGGAAGTAGGTGTGG - Intronic
974577414 4:63744741-63744763 GGGCCTGCTGGCGGAGGGGCGGG + Intergenic
975299618 4:72774819-72774841 GAGCCTGTAGGGGGAAGGGGGGG - Intergenic
976484142 4:85580760-85580782 TTGCCTGTAGCCGGAAGGGGAGG + Intronic
978061439 4:104344887-104344909 GTTCCTGGGTGGGGAAGGGGAGG + Intergenic
978954651 4:114598995-114599017 GTTCCAGAGGGCGGAAGGGGGGG + Intronic
979194422 4:117903345-117903367 GTGCCTGTTGGAGGGAGGGGAGG + Intergenic
983904452 4:173169255-173169277 GGGACTGCGGGCGGAGCGGGCGG + Intronic
985544233 5:501129-501151 GTGCCTGGAGGAGGAAGGGCCGG + Intronic
985575232 5:670730-670752 GGGCTTGCGGGAGGCAGGGGCGG - Intronic
985635586 5:1034216-1034238 GTGCCTGTGGGGGGACGTGGGGG - Exonic
986233553 5:5887159-5887181 GTGCCAGGGGTGGGAAGGGGTGG + Intergenic
986742171 5:10713705-10713727 GTGCCTGCTGGCTGGAGGGACGG - Intronic
987613598 5:20242372-20242394 GAGGCTGCGGGCTGAAGGAGTGG - Intronic
990155467 5:52872370-52872392 GTGCCTGATGGCTGGAGGGGTGG - Intronic
995206647 5:109488029-109488051 GTGCCGGCGGGCGGAACTGCTGG + Intergenic
998350332 5:141496229-141496251 CCCCCTGCGGGCTGAAGGGGAGG + Intronic
998378929 5:141710245-141710267 GAGCCTGTGGGCAGAAGAGGGGG + Intergenic
1001556556 5:172641218-172641240 GCGCCTGCGGGAGGAGGAGGCGG - Intergenic
1002184229 5:177446865-177446887 GGGCCTGCGGGGGGAGGCGGCGG - Exonic
1003995665 6:11537724-11537746 GCGGCTGCGGGTGGAGGGGGCGG + Intergenic
1006379261 6:33688170-33688192 GGGCCTGTGGGCAGCAGGGGCGG + Intronic
1007906608 6:45467602-45467624 GTGGCTGGGGGCGGTGGGGGTGG - Intronic
1009036370 6:58121472-58121494 GTGGCTGGGGGTGGTAGGGGTGG - Intergenic
1009302951 6:62050283-62050305 GGGCCTGTGGGGGTAAGGGGAGG + Intronic
1011034410 6:82957715-82957737 GGACCTGCTGGGGGAAGGGGTGG + Intronic
1011559399 6:88599554-88599576 GTGGTTGCGGCGGGAAGGGGGGG + Intergenic
1013193031 6:107820085-107820107 CTGCCTTCAGGCGGATGGGGTGG - Intronic
1017696588 6:157021722-157021744 GAGCCTGCGGGCGCGCGGGGCGG - Intronic
1019111944 6:169724048-169724070 GGGCGGGCGGGCGGAGGGGGCGG - Exonic
1019578216 7:1747720-1747742 GTGCCTGTGGACGGCCGGGGTGG + Exonic
1019731496 7:2631903-2631925 GGGCCGGCGGGCGGACGGGCGGG + Intergenic
1020262054 7:6536256-6536278 GAGGCTGCTGGAGGAAGGGGCGG - Intronic
1020382995 7:7566790-7566812 GCGCTTTCGGGCGGAAGGCGGGG + Intergenic
1021409664 7:20315687-20315709 GTGTGTGCTGGGGGAAGGGGAGG + Intergenic
1027264142 7:76484662-76484684 GTGGCTGCGGTGGGCAGGGGTGG - Intronic
1027315511 7:76982776-76982798 GTGGCTGCGGTGGGCAGGGGTGG - Intergenic
1029541094 7:101182509-101182531 GTGGCTTCTGGCGAAAGGGGCGG - Intergenic
1029732608 7:102447884-102447906 GTGGCTGCGGGGGGTGGGGGAGG - Exonic
1032201640 7:129826233-129826255 GTCCCTGGGGGCGGACTGGGTGG - Intergenic
1032581565 7:133107896-133107918 GTGGTGGCGGGTGGAAGGGGAGG - Intergenic
1034714540 7:153229161-153229183 GGGCCTGTTGGTGGAAGGGGAGG - Intergenic
1034972643 7:155428663-155428685 GTGCCTGCGGGTGGTGGGGCGGG - Intergenic
1035582279 8:747719-747741 GTGTCTGCGGTGGGATGGGGGGG + Intergenic
1035602643 8:905799-905821 GTGCTTGGGGGCGGGAGGGTGGG - Intergenic
1037470106 8:19200152-19200174 GTGCCTTGGGTGGGAAGGGGTGG - Intergenic
1038540217 8:28385485-28385507 GAGCGTGCGGGCAGAGGGGGCGG + Intronic
1038644006 8:29348751-29348773 GCGCCTGCGGGGGGGAGGAGCGG + Intronic
1047583936 8:126248598-126248620 GTGCCTGTGTGCTGGAGGGGAGG + Intergenic
1048317671 8:133374361-133374383 GTGACATCGGGCGGCAGGGGTGG - Intergenic
1048538770 8:135323318-135323340 GTACATGCGGGAGGAAGTGGTGG - Intergenic
1049407884 8:142459879-142459901 CTGCCTGCTGGGGGCAGGGGCGG - Intronic
1049578534 8:143400500-143400522 CTGGCTGAGGGCGGGAGGGGTGG + Intergenic
1049688012 8:143946713-143946735 GGGCCTGCAGCGGGAAGGGGAGG - Intronic
1051483129 9:17579791-17579813 GAGCCTGCGGGCGGCGGGGAAGG - Intronic
1051606271 9:18920453-18920475 CTGCATGAGGGCTGAAGGGGTGG - Intergenic
1056475426 9:86947333-86947355 GTTGCCGCGGGCGGAGGGGGAGG - Intergenic
1057421595 9:94917414-94917436 AGGCATGAGGGCGGAAGGGGAGG - Intronic
1058877509 9:109257365-109257387 GTGCCTGCAGGGGGAATGGAGGG + Intronic
1060152124 9:121295553-121295575 GTGGCTGGGGATGGAAGGGGCGG + Intronic
1060157693 9:121331461-121331483 GTGCCTGGGGGCGGGGGGAGGGG + Intronic
1061043022 9:128150607-128150629 GTGCCTGGGAGCGGGAGGAGGGG + Intronic
1061095871 9:128456504-128456526 CTGCCCGCGGGCGGCAGAGGAGG - Exonic
1061252900 9:129437075-129437097 GTGCGTGCCGGCGGGAGGAGGGG + Intergenic
1061680860 9:132241857-132241879 TTGGCTGCAGGCGGAGGGGGCGG - Exonic
1061880923 9:133568491-133568513 GTGCCTGCGGGAGCAAGCCGGGG + Intronic
1062219891 9:135409495-135409517 GGGACTGCGGGTGGAACGGGTGG + Intergenic
1062284175 9:135765765-135765787 GTGCTGGTGGGCGGAGGGGGTGG + Intronic
1062284702 9:135767836-135767858 GGGCCTGGGGGAGGAAGGGCAGG + Intronic
1062284812 9:135768233-135768255 ATGCCTGCGGGGGGGGGGGGGGG + Intronic
1062491573 9:136807553-136807575 GTGTCTGCGGGCGGAGGCGGCGG - Exonic
1186434120 X:9528682-9528704 GAGCTTGCGGGGGGAGGGGGTGG + Intronic
1189473910 X:41334542-41334564 GCGCAGGCGGGCGGAGGGGGAGG + Intronic
1191710930 X:64149451-64149473 GGGCATGCTGGTGGAAGGGGTGG + Intergenic
1196874745 X:120147208-120147230 GTGGCTGGGGGCGGCAGGAGTGG + Intergenic
1197774620 X:130110989-130111011 GGGACTGCGGGCGGGCGGGGTGG + Intergenic
1199892018 X:152094436-152094458 GTGCCTGGGGGTGGGTGGGGTGG + Intergenic