ID: 1152071787

View in Genome Browser
Species Human (GRCh38)
Location 17:78137784-78137806
Sequence CAGGGTGACCAGGAAGGCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 432}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152071787_1152071802 15 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071802 17:78137822-78137844 CCGGGGTGACACCTCCAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1152071787_1152071804 19 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071804 17:78137826-78137848 GGTGACACCTCCAGAAGGGCGGG 0: 1
1: 0
2: 2
3: 13
4: 174
1152071787_1152071795 -3 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071795 17:78137804-78137826 CTGCCTCGGAGGTGAGCCCCGGG 0: 1
1: 0
2: 2
3: 15
4: 157
1152071787_1152071805 20 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071805 17:78137827-78137849 GTGACACCTCCAGAAGGGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 139
1152071787_1152071800 14 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071800 17:78137821-78137843 CCCGGGGTGACACCTCCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 81
1152071787_1152071794 -4 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071794 17:78137803-78137825 CCTGCCTCGGAGGTGAGCCCCGG 0: 1
1: 0
2: 4
3: 23
4: 239
1152071787_1152071796 -2 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071796 17:78137805-78137827 TGCCTCGGAGGTGAGCCCCGGGG 0: 1
1: 0
2: 1
3: 12
4: 113
1152071787_1152071806 21 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071806 17:78137828-78137850 TGACACCTCCAGAAGGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 126
1152071787_1152071803 18 Left 1152071787 17:78137784-78137806 CCTTCGCCTTCCTGGTCACCCTG 0: 1
1: 1
2: 1
3: 44
4: 432
Right 1152071803 17:78137825-78137847 GGGTGACACCTCCAGAAGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152071787 Original CRISPR CAGGGTGACCAGGAAGGCGA AGG (reversed) Exonic
900465805 1:2824974-2824996 CAGGGGGTCCAGGAAGGAGGTGG + Intergenic
900466863 1:2830017-2830039 CAGGGGGACCAGGAAGACGCTGG - Intergenic
900548676 1:3242646-3242668 CAGGGTGACCCGGAAGGCGATGG + Intronic
900595515 1:3478537-3478559 CAGGGTCACCTGGAAGGGGTGGG - Exonic
900692107 1:3987250-3987272 CAGGGAGACCCAGGAGGCGAGGG - Intergenic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901487619 1:9575947-9575969 CAGCATGACCAGGAAGGGGAAGG - Intronic
901927930 1:12578810-12578832 CAGGCTCTCCATGAAGGCGAAGG + Exonic
901959637 1:12814997-12815019 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
902280514 1:15371049-15371071 CAGGGCAACCAGGAAGGCAGGGG + Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902754224 1:18538524-18538546 GAAGGTGACAAGGAAGGTGAAGG - Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
904093380 1:27960128-27960150 CAGGTCGAGCAGGAAGGCGGCGG - Exonic
905198970 1:36303796-36303818 CATGATGACCGTGAAGGCGAAGG + Exonic
905313529 1:37066629-37066651 GATGGTGACCAGGAAGGGCAGGG + Intergenic
905819925 1:40980890-40980912 CAGGGTGAACAGGCAGGTGCAGG - Intronic
906399748 1:45496227-45496249 CAAAGTGGCCAGGAAGGCAAGGG - Exonic
906733758 1:48104985-48105007 CAGGGAGAAAAGGAAGGGGAGGG + Intergenic
907481361 1:54747659-54747681 CAGGTAGACCAGGCAGGGGAAGG - Intergenic
909070478 1:70987205-70987227 AAAGGTGACCAGGAAGGAAATGG + Intronic
909075553 1:71047404-71047426 CATGGTGATCGGGAAGGCCACGG + Exonic
911239880 1:95453581-95453603 TAGGGTGGCCAGGAAGACAAAGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
913335677 1:117707345-117707367 CAGGGGGACCAGCAAGGCAGGGG - Intergenic
913493150 1:119401320-119401342 CAGGGCGATCAGGCAGGAGAAGG - Intergenic
914996721 1:152549784-152549806 CAGGGTAATCAGGCAGGAGAAGG - Intronic
915003565 1:152615597-152615619 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
915267620 1:154730392-154730414 CATGGACACCAGGAAGGCCAAGG - Intronic
915293455 1:154902313-154902335 CTGGGTGACTGGGAAGGTGATGG + Intergenic
916456651 1:164977787-164977809 AAGGGTGTGCAGGAAGGGGAAGG + Intergenic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917984702 1:180304254-180304276 CAGGGTAATCAGGCAGGAGAAGG + Intronic
918175073 1:182036271-182036293 CAGGGGGACCAGGATGGTGTGGG + Intergenic
918527553 1:185481318-185481340 CAGGTTGAACAGGTAAGCGACGG - Intergenic
919765646 1:201125616-201125638 CAAGGTGAACAGCAAGGCGAGGG - Intronic
920857735 1:209676438-209676460 GAGGGTGAGCAGGTGGGCGATGG + Intergenic
920864971 1:209744353-209744375 CAGGGAAACCAGGAAGGAGTTGG - Intergenic
921493088 1:215803280-215803302 CAGGGCAACCAGGCAGGAGAAGG + Intronic
923324210 1:232866489-232866511 AAGGCTGACCAGGATGGAGAGGG - Intergenic
923495326 1:234519625-234519647 AAGTGTGACAAGGCAGGCGAGGG + Intergenic
923575713 1:235157219-235157241 AAGGGAGACCAGTAAGGAGATGG + Intronic
1063188116 10:3668550-3668572 CAGGGAGACCAGGCAGGCTGAGG + Intergenic
1065904467 10:30237871-30237893 CAGGGTCAGAAGGAAGGAGATGG + Intergenic
1066010678 10:31191250-31191272 AAAGGTGACCAGGAAAGCTATGG - Intergenic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1069032909 10:63617054-63617076 CAGTGTGGCAAGGAAGGGGATGG - Intronic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1072974256 10:100043962-100043984 CAGGCTGAAGAGGAAGGAGAGGG + Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1073948944 10:108784847-108784869 CAGGGTGGAGAGGAAGACGATGG - Intergenic
1074057300 10:109934047-109934069 CAGGGTGAGCAGGAAGCTGTGGG + Intergenic
1074098746 10:110336346-110336368 CTGTGTTACAAGGAAGGCGAAGG + Intergenic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1075316143 10:121455168-121455190 CAAGGCCACCAGGAAGGAGAAGG - Intergenic
1075780812 10:125016067-125016089 CGGGGTGACGGGGAAGGGGATGG + Intronic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076516356 10:131046887-131046909 CTGGGTGAGCAGGAGGGCCAGGG + Intergenic
1076709368 10:132323311-132323333 ATGGGTGACCAGGAAGCCAAGGG - Intronic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077410818 11:2403178-2403200 CTGGGAGCCCAGGAAGGCCAGGG - Exonic
1077498445 11:2897923-2897945 AAGGGTGACCTGGAAGGAGCGGG - Intronic
1077672523 11:4168649-4168671 CATGGGGGCCAGGAAGGAGAAGG - Intergenic
1078763536 11:14271880-14271902 CTGGATGACCAGGAAGGTGGTGG - Intergenic
1081076175 11:38676636-38676658 CAGGAAGACCAGGAAGTAGAGGG + Intergenic
1082009653 11:47441616-47441638 CTGGGTGGCCAGGAAGGCGCTGG - Exonic
1082112079 11:48288167-48288189 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082247894 11:49946072-49946094 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082559033 11:54597290-54597312 CAAGGTGATCAGGCAGGAGAAGG - Intergenic
1083063402 11:59898252-59898274 CAGGGTCAGCAGGAAGGCGGCGG - Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083429879 11:62608789-62608811 CAGGGTGAACAGCAAGGCTAAGG + Exonic
1083960346 11:66011868-66011890 CAGGGAGCCCAGGAGGCCGAGGG - Exonic
1084166008 11:67375035-67375057 CAGGGGCACCAGGAAGGAGTGGG - Intronic
1084319441 11:68365310-68365332 GAGGGTGGCCAGGAAGGTCACGG + Intronic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1090049240 11:123362841-123362863 CAGGCTGCCCCGGAAGGCAAGGG + Intergenic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091355008 11:134930677-134930699 AAGGGTGACCAGGATGGCAGTGG + Intergenic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1092772798 12:11913301-11913323 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1092916723 12:13196193-13196215 CAGGGAGGCCCTGAAGGCGAAGG - Intergenic
1093477103 12:19568212-19568234 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1095905303 12:47371185-47371207 TAGGTTGACCAGGTAGGAGAAGG - Intergenic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096898675 12:54851656-54851678 CAGGGCGATCAGGCAGGAGAAGG + Intronic
1099814971 12:87633665-87633687 CAGGGCGATCAGGCAGGAGAAGG + Intergenic
1101028689 12:100638816-100638838 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1101447232 12:104745932-104745954 CAGGGTGATCAGGCAAGAGAAGG - Intronic
1101819173 12:108169961-108169983 CAGGGTGGCCAAGAAGCTGAAGG + Intronic
1101874932 12:108591722-108591744 GAGGGGGACCAGGAAGTCCAGGG - Exonic
1103098042 12:118147772-118147794 CAGGGGGACTAGGAAGGCTGAGG - Intergenic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104615324 12:130263344-130263366 CAGCGTGACCAGGAAGAACAGGG + Intergenic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1104974282 12:132545554-132545576 CAGGCTGACCACACAGGCGAGGG - Intronic
1106110316 13:26771431-26771453 CCAGGTGACCAGGAAGGGCAGGG - Intergenic
1106133159 13:26955675-26955697 CCGGGTGGCAAGGAAGGCCAGGG + Intergenic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1109966834 13:69710886-69710908 CACTCTGACCAGGAAGGCCAAGG - Intronic
1110830972 13:80030366-80030388 CTGGGAGACAAGGAAGGAGATGG + Intergenic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1113292687 13:108923608-108923630 CAGTGAAAGCAGGAAGGCGAGGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1115497832 14:34024567-34024589 CATGCTGACCGGGAAGGAGAGGG - Intronic
1116404701 14:44553544-44553566 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1117072196 14:52067912-52067934 CCAGGTGGCCAGGAAGGCGTGGG + Exonic
1117775997 14:59185161-59185183 CAGGGTGACCTGGAAGAAGCTGG + Intergenic
1118438707 14:65793548-65793570 GAGGGTGTCCAGGAAGGATATGG + Intergenic
1118482976 14:66185727-66185749 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1118484832 14:66204603-66204625 CAGGGCAACCAGGCAGGAGAAGG + Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1121114095 14:91331475-91331497 CATGGTGACCAGGAACGGGGTGG - Intronic
1121276331 14:92670495-92670517 CAGGCTGCTCAGGAAGGAGAGGG + Intronic
1121580343 14:95025291-95025313 CAGGGTGGCCAGGCAGGCAGGGG + Intergenic
1121716783 14:96081977-96081999 CAGGGTGACCTGGGGGGCGAGGG - Intronic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1122999595 14:105286173-105286195 CAGGGTGACGAGGAAGTGGCAGG + Intronic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1125796922 15:42410059-42410081 CAGGGTGCCCAGTCAGGCAAAGG + Intronic
1129609618 15:77042934-77042956 CAGTGTGACAAGGAAGGGCAAGG - Exonic
1129644797 15:77420052-77420074 CGTGGTCACCAGGAAGGGGACGG - Exonic
1129714757 15:77840496-77840518 CAGGGAGACCAGGTAGGCTTTGG - Intergenic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131158325 15:90088576-90088598 CATGGCGACCAGGTAGGCCAGGG - Exonic
1131188700 15:90295491-90295513 CAGGGTGAGCAGGCAGGAGCAGG + Intronic
1132815203 16:1822533-1822555 CAGGCTGAGCAGGAAGGAGAAGG - Intronic
1133846027 16:9454583-9454605 CAGGGTGCCAAGAAAGGAGATGG - Intergenic
1134202510 16:12210618-12210640 CAGGGGGACCAGAAAGGTGGTGG - Intronic
1135303617 16:21350839-21350861 CAGAGTGTCCAGGAAGGGGCAGG + Intergenic
1135697560 16:24603379-24603401 CAGGGAGTCCAGGGAGGCCAAGG - Intergenic
1136300363 16:29330034-29330056 CAGAGTGTCCAGGAAGGGGCAGG + Intergenic
1137224885 16:46493989-46494011 CAGGGCGATCAGGCAGGAGAAGG + Intergenic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1138527336 16:57616616-57616638 CAGGGGGTTCAGGAACGCGACGG - Intronic
1139432075 16:66916195-66916217 CAGGGTGACCTGGCAGGGAAGGG + Exonic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1141592296 16:85077119-85077141 CAGGGTCTGCAGGCAGGCGAGGG - Intronic
1141593362 16:85082991-85083013 CAGTGTGAACAGTAAGGCCAAGG - Intronic
1142062089 16:88036796-88036818 CAGAGTGTCCAGGAAGGAGCAGG + Intronic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142210550 16:88806481-88806503 CAGGGAGGCCAGGAAGGCCTGGG - Exonic
1143408557 17:6694799-6694821 CAGGGTGACCATGAAGACTTTGG + Intronic
1143887557 17:10076247-10076269 CAGGGGGACGGGGAAGGGGAGGG + Intronic
1144038919 17:11391216-11391238 GAGGGTGGGCAGGAAGGTGATGG + Intronic
1144287239 17:13788604-13788626 AAGGGTGAGGAGGAAGGCCATGG - Intergenic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1145686832 17:26677543-26677565 CAGGGTAATTAGGAAGGAGAAGG + Intergenic
1146054505 17:29574393-29574415 GAGGGTGCCCTAGAAGGCGAGGG + Exonic
1147255344 17:39177882-39177904 CAGGGTGACCAGGAACACCTGGG - Intronic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1148387306 17:47243576-47243598 CAGGGTCCCAAGGAGGGCGACGG + Intergenic
1148980517 17:51570371-51570393 CAGGGCGATCAGGCAGGAGAAGG + Intergenic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1149721392 17:58848267-58848289 CAGGGTAATCAGGCAGGAGAAGG - Intronic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1150427282 17:65086716-65086738 AAGGGAGAACAGGAAGGGGAAGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151365384 17:73613360-73613382 CAGGGGGACCTGGAGGGCGGGGG - Intronic
1151837569 17:76593289-76593311 CAGGGTGCCCAGGAAGGGCATGG + Intergenic
1152059779 17:78063381-78063403 CAGGCTGAGGAGGAAGGGGAGGG + Intronic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152087080 17:78226880-78226902 CAGCGGGACCAGGAAGGGAAGGG + Intergenic
1152419140 17:80182695-80182717 CAGGCTCTCCAGGAAGGCGATGG - Exonic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1153678333 18:7476186-7476208 CAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1153709437 18:7783202-7783224 AAGGGTGATCAGCAAGGGGATGG + Intronic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1155163552 18:23214902-23214924 CATGGTGAGCAGGAAGGCCTGGG - Intronic
1155660639 18:28244447-28244469 CAGGGCAATCAGGCAGGCGAAGG + Intergenic
1155674921 18:28418535-28418557 CAGGGCAATCAGGCAGGCGAAGG - Intergenic
1157080722 18:44522302-44522324 CAGGGTGACCTGGCAGGAAAGGG + Intergenic
1157222964 18:45840299-45840321 CAGGGGGTCCAGGCAGGAGAAGG + Intronic
1157385095 18:47253684-47253706 CAGGGTAACCTGGAATGGGAGGG - Intergenic
1158530372 18:58255612-58255634 CAGGGGGGCCAGGAGGGCTAGGG - Intronic
1160803472 19:980792-980814 CAGGGGCAGCAGGAAGTCGATGG - Intergenic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162465072 19:10834992-10835014 CAGGATGACGAGGAGGTCGAAGG - Exonic
1162536800 19:11267340-11267362 GAGGGTGATCAGGACTGCGATGG - Intergenic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1162829829 19:13277511-13277533 CAGGATGCCCAGGAAAGCAAGGG - Intronic
1162917079 19:13880468-13880490 GAGGGAGAGCAGGAGGGCGAAGG - Exonic
1163645245 19:18485529-18485551 CAGGGAGACCAGGGAGACCAGGG + Intronic
1165501643 19:36194222-36194244 CATGGTGCCCAGGTAAGCGAGGG - Exonic
1166397803 19:42455100-42455122 GAGGCTGAACAGGAAGGCAAGGG - Intergenic
1166438445 19:42789439-42789461 CAGTGTGAGCAGGAAGGAAATGG + Intronic
1166467333 19:43044088-43044110 CAGTGTGAGCAGGAAGGAAATGG + Intronic
1166473468 19:43100173-43100195 CAGTGTGAGCAGGAAGGAAATGG + Intronic
1166917743 19:46207147-46207169 TGGGGTGTCCAGGAAGGCCAGGG - Intergenic
1167103523 19:47418292-47418314 CAGGGTGCCCAGCCAGGCGAGGG - Intronic
1168057998 19:53874182-53874204 CAGGTTCAGCAGGATGGCGATGG - Exonic
1168332579 19:55578858-55578880 GAGGGCGAACAGGAAGGGGAAGG - Exonic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
925070829 2:965424-965446 CAGGGAGACCAAGGAGGCCAAGG - Intronic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
927961420 2:27242663-27242685 CTGGGTGAGCAGGCAGGCCAGGG - Exonic
928114479 2:28537279-28537301 CAGGAAGACAAGGAAGGCCAAGG - Intronic
928168264 2:28986604-28986626 CAGGGTGAGCAGGAAGCAGTGGG - Intronic
928795737 2:35016577-35016599 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928878314 2:36067191-36067213 CAGGTTGACCAGAAAGGTAAAGG + Intergenic
929563162 2:42968350-42968372 GAGGGTGAAATGGAAGGCGATGG + Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
931570106 2:63659517-63659539 CAATGTGACCAGGAAGGCAGAGG + Intronic
932706678 2:74031345-74031367 CGGGGTGATGAGGAAGGCCACGG - Intronic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
937147942 2:119663439-119663461 CATGGTGAGGAGGAAGGGGAGGG - Intergenic
937249402 2:120514065-120514087 CAGGGTGGCCAGGCAGGAAAAGG - Intergenic
938117098 2:128609451-128609473 AAGAGTGACCAGGAAGGCTCCGG - Intergenic
938314417 2:130316071-130316093 CAGGGGGAGCAGGAAGCCCAGGG + Intergenic
938893027 2:135724308-135724330 CAGGGGAACCATAAAGGCGAAGG - Exonic
939544706 2:143538373-143538395 CAGGGTAATCAGGCAGGAGAAGG - Intronic
939760504 2:146171534-146171556 CAGGGTGTCAAGGAAGGAGATGG + Intergenic
940836388 2:158526632-158526654 CAGGGCGATCAGGCAGGAGAAGG + Intronic
941440787 2:165532707-165532729 CAGGGTGATCAGGCAGGAGAAGG + Intronic
942535692 2:176960867-176960889 CAGGAAGCCCAGGAAGGAGAAGG + Intergenic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
945034585 2:205693685-205693707 CTGGGTTACCAGGAAAGGGAGGG - Intronic
947167820 2:227280532-227280554 CAGGGAGACCTGGAAGTCCAGGG - Exonic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
947308871 2:228778349-228778371 CAGGCTGTCCAGCAAGGAGATGG - Intergenic
947865931 2:233397732-233397754 GAGGGTGAACTGGAAGGGGAGGG + Intronic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
948640571 2:239373372-239373394 CAGTGTGACCAGGCAGCCCAGGG - Intronic
948662007 2:239513362-239513384 AAGGGGGAGCAGGCAGGCGAAGG - Intergenic
948687532 2:239678264-239678286 CAGGGTCTCCAGGAAGGTGTCGG - Intergenic
948752640 2:240141373-240141395 CAGGGTGACCAGGAATGACAGGG - Intronic
948853934 2:240721361-240721383 CATGGGGACAAGGAAGGCCATGG + Intronic
949056849 2:241932489-241932511 CAAGGTTTCCAGGAAGGGGAAGG - Intergenic
1168788875 20:562744-562766 CAGGGTGTCCAGGTAGGCATAGG + Intergenic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1168835145 20:872849-872871 CAGGGTGTCAGGGAAGGCGGTGG + Exonic
1169093962 20:2879458-2879480 CATGGTGAGCAGGAAGGGGCAGG + Intronic
1169723314 20:8702239-8702261 CATGGCCACCAGGAAGGCTAAGG - Intronic
1170444027 20:16406367-16406389 CAGGGAGAAGAGGAAGGTGAGGG - Exonic
1171145254 20:22775738-22775760 CAGGGTGACTGGGCAGGAGAAGG + Intergenic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1172227208 20:33313013-33313035 CTGAGTCACCAGGAAGGCGCAGG - Intergenic
1172539342 20:35699100-35699122 CAGGGTGGACAGGAAGGCTCCGG + Intronic
1172785284 20:37464585-37464607 AAGGGTGCCCAGGAAGGAGGGGG - Intergenic
1172872593 20:38144940-38144962 CAGGGTGACCAGGATGACCAGGG + Intronic
1173163746 20:40671640-40671662 CAGGGACACCAGGAAGGGCATGG + Intergenic
1173323607 20:42011958-42011980 CAAGCTGACCAGGAAGGAGAGGG - Intergenic
1173662926 20:44746335-44746357 CAGGGAGACGAGGGAGGCGAAGG - Intronic
1174280333 20:49434524-49434546 CAGGGAGCCCAGGAAGATGATGG - Intronic
1175555778 20:59855226-59855248 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1175873996 20:62220850-62220872 CAGGGTGACCCGCAAGGCGCAGG + Intergenic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1180159858 21:45994182-45994204 CAGGGTGATCAGGGAAGAGAAGG + Exonic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1181442735 22:22945031-22945053 CCAGGTGACCAGGAAGGAGGAGG + Intergenic
1181514038 22:23401551-23401573 CAGGGTGTCCTGGAAGGGGCTGG - Intergenic
1181805945 22:25374539-25374561 GAGGGTGGCCAGGAAGGTCACGG - Intronic
1182440614 22:30361871-30361893 AAGGCTGTCCAGGAAGGAGAAGG - Intronic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1182662165 22:31932961-31932983 GAGGGAGACCAGGAAGGGGCGGG + Intergenic
1183030876 22:35103784-35103806 CAAGGTCACCAGGAGGTCGATGG + Intergenic
1184247766 22:43244382-43244404 CAAGGTGACCAGCACGGCGGAGG + Intronic
1184280601 22:43435331-43435353 GAGGGTGACCAGGCAGGCACAGG - Intronic
1184415603 22:44350262-44350284 CAGGGTCCCCAGAAAGGCAAAGG + Intergenic
1184691079 22:46117549-46117571 GAGGTGGACCAGGAAGGGGAAGG + Intergenic
1185046157 22:48529639-48529661 GAGGGTGTCCAGGCAGGAGATGG + Intronic
1185295276 22:50049950-50049972 CAGGGAGGCCAGGAGGGTGATGG + Intronic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950467410 3:13163453-13163475 CTGGGGGACCAAGAAGGCCATGG - Intergenic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
951816296 3:26758828-26758850 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
951963485 3:28355000-28355022 CAGGGTAATCAGGCAGGAGAAGG + Intronic
951964360 3:28366137-28366159 CAGGGTAATCAGGCAGGAGAAGG - Intronic
952233503 3:31455677-31455699 CATGATGACCATGAAGGTGAAGG + Intergenic
952693148 3:36233665-36233687 CAGGGTGCCAAGCAAGGAGATGG - Intergenic
953266040 3:41389365-41389387 CAGGGTAATCAGGCAGGAGAAGG - Intronic
953395194 3:42563599-42563621 CAGGGTCTCCAGGAAGCAGAAGG + Exonic
953896811 3:46809357-46809379 CAGGGTCACCAGGATGCCCAGGG + Intronic
954698466 3:52439829-52439851 CAGGGTGGCCAGGCTGGAGAGGG - Intronic
955650488 3:61189080-61189102 CAGGGCGATCAGGCAGGAGAAGG + Intronic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
957924140 3:86787154-86787176 CAGGGTGTGTAGGAAGGCAAAGG - Intergenic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
961086375 3:124071082-124071104 GAAGGTGATCAGGAAGGGGAGGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
963127386 3:141827958-141827980 GAGGGTGCCCAAGAGGGCGAGGG + Intergenic
966231898 3:177661356-177661378 CAGGGCGATCAGGCAGGAGAAGG - Intergenic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
968470784 4:781465-781487 CAGGGTCACCCGGAGCGCGAAGG + Intergenic
968528305 4:1076173-1076195 CAAGGTGCCCGGGAAGGCAAGGG - Intronic
968602287 4:1515875-1515897 CAGGGAGGGGAGGAAGGCGAGGG + Intergenic
968977844 4:3831110-3831132 CAGTGAGACCAGGAAGGGGAGGG + Intergenic
969528221 4:7714987-7715009 CAGGGTAACAAGGGAGGCAAAGG - Intronic
969530352 4:7726986-7727008 CAGGGTGACCAGGACATCCATGG - Intronic
969624286 4:8294492-8294514 CAGGGAGTCCAGGAAGCTGATGG - Intronic
970998431 4:22294561-22294583 CATTGTGACCAGGAAGCCGAGGG - Intergenic
972248629 4:37275077-37275099 CAGGGCAACCAGGCAGGAGAAGG + Intronic
972275929 4:37557863-37557885 CAGTTTGCCCAGGAAGGCAAGGG - Intronic
973263616 4:48188107-48188129 TAGGGCGACAAGGAAGGGGATGG - Intronic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973888462 4:55346404-55346426 TAGGGTCAGCAGGAAGGCGGCGG - Exonic
976221928 4:82762958-82762980 GAGGGGGACCAGGAAGGCGATGG - Intronic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978565856 4:110080739-110080761 CAGGGTAATCAGGCAGGAGAAGG + Intronic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
982275332 4:153631828-153631850 CAGTGTAGCCAGGAAGGAGAGGG - Intronic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
988274108 5:29058085-29058107 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
989412598 5:41137519-41137541 CAGGGCAACCAGGCAGGAGAAGG + Intergenic
990084349 5:51955931-51955953 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
991383559 5:66059531-66059553 CAGGGTAATCAGGCAGGAGAAGG - Intronic
992124481 5:73626419-73626441 CAGGGTCCCCAGGGATGCGAGGG + Intronic
995383923 5:111567583-111567605 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
997656983 5:135562515-135562537 GAGGGTGACCTGGAAGGCAGGGG + Intergenic
998307771 5:141096292-141096314 GATGGAGACCAGGGAGGCGAGGG - Exonic
998310318 5:141123491-141123513 GATGGAGACCAGGGAGGCGAGGG - Exonic
998313448 5:141157494-141157516 GATGGAGACCAGGGAGGCGAGGG - Intergenic
998314939 5:141174331-141174353 GATGGAGACCAGGGAGGCGAGGG - Exonic
998315516 5:141179533-141179555 GATGGAGACCAGGGAGGCGAGGG - Exonic
998316058 5:141184055-141184077 GATGGAGACCAGGGAGGCGAGGG - Exonic
998316613 5:141188814-141188836 GATGGAGACCAGGGAGGCGAGGG - Exonic
998317247 5:141194048-141194070 GATGGAGACCAGGGAGGCGAGGG - Exonic
998317920 5:141201270-141201292 GATGGAGACCAGGGAGGCGAGGG - Exonic
998318876 5:141210403-141210425 GATGGAGACCAGGGAGGCGAGGG - Exonic
998322005 5:141241412-141241434 GATGGAGACCAGGGAGGCGAGGG - Intergenic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
1000587527 5:163118835-163118857 CAGGATGATCAGGTAGGAGAAGG - Intergenic
1001316127 5:170642308-170642330 CAGGGGGACCTGGAAGGCAAAGG + Intronic
1001597435 5:172907147-172907169 GAGGGAGACCAGGCAGGGGATGG - Intronic
1001712400 5:173789270-173789292 CAGGGTGAGGAGGAAGCCAATGG - Intergenic
1001835109 5:174825085-174825107 CAGGGAGACCAGCAAGGAGGTGG - Intergenic
1002163594 5:177331660-177331682 CAGGGTGAACAGGAAGGCCTGGG + Exonic
1002213109 5:177609944-177609966 TAGGGTGAGCAGGAAGGCAGGGG - Exonic
1002799041 6:503861-503883 CAGGCTGAGGAGGAAGGCGAGGG - Intronic
1003513114 6:6797835-6797857 AAGGGAGAGCAGGAAGGCCAGGG - Intergenic
1003669064 6:8139123-8139145 CAAAGTGACCAGGAAGGAGAGGG - Intergenic
1004198323 6:13525521-13525543 CTGGGTGACAAGGAAGGATAAGG - Intergenic
1005054899 6:21720308-21720330 CAGGATGACCAGGAAGGACCAGG - Intergenic
1005449823 6:25961832-25961854 CAGGGTCAGCAGGCAGGCCAGGG + Intergenic
1005558520 6:27012557-27012579 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1006297971 6:33178452-33178474 CAGGGGGACCAGGAAGGCCCTGG + Exonic
1008068863 6:47079283-47079305 AAGGGAGAGCAGGAAGGAGACGG + Intergenic
1008131099 6:47720717-47720739 CAGGGGCACCAGGAAGGCTCTGG + Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1010364511 6:75033642-75033664 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1010975389 6:82307074-82307096 CAGAGTGAACAGGAAGGCCTGGG + Intergenic
1011695918 6:89912523-89912545 GGCGGTGACCAGGAAGGGGAGGG + Intergenic
1011708943 6:90031351-90031373 CAGGGCAACCAGGCAGGAGAAGG + Intronic
1012723368 6:102777727-102777749 CTGGGTGACCAGGGAGGACAAGG + Intergenic
1015479209 6:133689686-133689708 GAGGGTCACCATGATGGCGAGGG + Intergenic
1016384194 6:143515071-143515093 CAGGGTGCCCAGGCGGGAGATGG + Intergenic
1016409706 6:143769340-143769362 CAGTGTGCCCAGGAACCCGAGGG + Intronic
1018073256 6:160185528-160185550 CAGGGCAATCAGGCAGGCGAAGG + Intronic
1018855341 6:167670492-167670514 CAGGGAGCCCAGGACGGAGAAGG - Intergenic
1019578221 7:1747735-1747757 CGGGGTGGCCAGGACGGCCAAGG + Exonic
1019685176 7:2377905-2377927 CTGGGTGTCGAGGAAGGAGAAGG + Intronic
1019685232 7:2378222-2378244 CTGGGTGTCGAGGAAGGAGAAGG + Intronic
1019716379 7:2541311-2541333 CAGCGTCCCCAGGAAGTCGAGGG + Exonic
1022801337 7:33780142-33780164 CAGGGTGACCAAGAAGCAGGTGG - Intergenic
1022970709 7:35514239-35514261 CAGGGAGACCTGGAAGCAGAAGG - Intergenic
1023138127 7:37074527-37074549 CTGGGTTCCCAGGAGGGCGAGGG + Intronic
1024054585 7:45651791-45651813 CTGAGTGACCAGGAAGGAGAGGG + Intronic
1024797540 7:53036516-53036538 CTGGGTGACCTCGAGGGCGAAGG - Exonic
1026505472 7:70979236-70979258 CAGGCTGGGCAGGAAAGCGATGG + Intergenic
1027125415 7:75553531-75553553 CAGGGAGGCCAGGTAGGCGAGGG + Exonic
1030281508 7:107780523-107780545 CAGGGGGAACAGGACGGTGAGGG - Intronic
1031985419 7:128161568-128161590 CTGTGGGACCAGAAAGGCGATGG - Intergenic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1033329218 7:140404226-140404248 CAGGTGAACCAGGAAGGCGAAGG + Intronic
1033715745 7:144000357-144000379 CATGTTCACCAGGAAGGTGATGG + Intergenic
1034271490 7:149805428-149805450 CAGGAGGACCAGGAAGTCCAGGG - Intergenic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1034423371 7:151000611-151000633 CAGACTGGCCAGGAAGGCAAAGG + Intronic
1034622072 7:152464032-152464054 GAGGGAGACCCGGAAGGCGGTGG + Intergenic
1034718953 7:153270277-153270299 CAGGGTGATCAGGCAGGAGAAGG + Intergenic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1039475737 8:37838595-37838617 GGGGGTGACCAGGAAGGAGAAGG - Intronic
1040530689 8:48264166-48264188 CAGGGGGACTAGGAAAGCCAAGG - Intergenic
1040541035 8:48355875-48355897 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1041024820 8:53673147-53673169 TGGGGGGACCAGGAAGGCCATGG + Intergenic
1041239660 8:55838701-55838723 CAATGTGATCAGGAAGGTGAAGG - Intergenic
1043546747 8:81324059-81324081 CAGGGTGACTAGAATGGCTAGGG - Intergenic
1044136163 8:88588748-88588770 CAGGGTCACCAAGCAGGCAAGGG + Intergenic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1045411928 8:101928934-101928956 CAGGGTGTCAGGGGAGGCGAGGG + Intronic
1046081204 8:109372498-109372520 CAGGGCAACCAGGCAGGAGAAGG - Intronic
1049658300 8:143808550-143808572 CTGGGTGCCCAGGAGGGCCAGGG + Intronic
1050007512 9:1148345-1148367 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1050960223 9:11720670-11720692 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1051583206 9:18699438-18699460 CCCAGTGACCAGGAAGGCTAAGG - Intronic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1052883698 9:33623126-33623148 CAAAGTGACTAGGAAGGTGAGGG + Intergenic
1053283484 9:36836331-36836353 CAGGGTGTCCAGCAAGGCAGGGG - Exonic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1053718368 9:40919923-40919945 CAGGGTAATCAGGCAGGAGAGGG + Intergenic
1054762059 9:69012816-69012838 CAGAGGGACCAGGAAGGCATGGG + Exonic
1055155386 9:73056821-73056843 CAGATTGACCAGGCAGGCAAGGG + Intronic
1056628411 9:88273170-88273192 CAGGGTGACCAGGAGGCCGTCGG + Intergenic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1059134872 9:111795278-111795300 CAGGGTTAGCCGGAGGGCGAGGG + Intergenic
1059349166 9:113652202-113652224 CAGGGTGACCTGGAAAGCACTGG + Intergenic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1059615517 9:115946711-115946733 CCAGGTGACCAGGAAGGGGGAGG + Intergenic
1060440674 9:123636253-123636275 CCAGGTGACCAGGAACACGACGG + Intronic
1060937463 9:127523973-127523995 CAAGGTGACCAGCAAGCCGGCGG + Intronic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1060992790 9:127858247-127858269 CTGGCTGGCCAGGAAGGCCAGGG + Intergenic
1061385532 9:130287235-130287257 CAGGGGGACCAGAAAGGCAGAGG - Intronic
1062068974 9:134545048-134545070 CAGTGTGAGCAGGCAGGCGGCGG + Intergenic
1062368894 9:136226450-136226472 CAAGGAGACCAGGACTGCGAGGG - Intronic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1186044374 X:5519236-5519258 CAGGATAACAAGGAAGGAGATGG - Intergenic
1186624295 X:11275829-11275851 CAGGGTGAGTAGGAAGGCATGGG - Intronic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1187453594 X:19421180-19421202 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1188483895 X:30661528-30661550 CAGGGTGTTCAGGTGGGCGAGGG - Intronic
1189293330 X:39901277-39901299 CAGGCTGACCCAGAAGGGGAAGG - Intergenic
1190967914 X:55319826-55319848 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1191758277 X:64618597-64618619 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1192073465 X:67965271-67965293 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1192560482 X:72124847-72124869 AAGGGTGACAAGGATGGCGAGGG - Intergenic
1192895915 X:75442300-75442322 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1193705579 X:84817285-84817307 CAGGGCGACTAGGCAGGAGAAGG + Intergenic
1193735453 X:85150963-85150985 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1193808078 X:86016966-86016988 CAGGGTGACCTGGATGTCAAAGG + Intronic
1194630189 X:96273512-96273534 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1195408925 X:104547848-104547870 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1195414974 X:104610279-104610301 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1195886953 X:109648672-109648694 CAGGGCGATCAGGCAGGAGAAGG + Intronic
1196077167 X:111590692-111590714 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1196204366 X:112922691-112922713 CAGGGTGTCCAGGAAAGCATAGG + Intergenic
1196350372 X:114722508-114722530 CAGGGCGATCAGGCAGGAGAAGG - Intronic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1197745877 X:129932102-129932124 CACGCTGGCCACGAAGGCGAAGG - Intergenic
1199386011 X:147223986-147224008 CAGGGCAACCAGGCAGGAGAAGG + Intergenic
1199483866 X:148327497-148327519 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1199833242 X:151563969-151563991 CAGGATGACCAGGAAAACGAGGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199996532 X:153029935-153029957 CAGGCATACCAGGAAGGCAAAGG - Intergenic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201974690 Y:19836096-19836118 CAGGGTAATCAGGCAGGAGAAGG - Intergenic