ID: 1152072900

View in Genome Browser
Species Human (GRCh38)
Location 17:78142885-78142907
Sequence GGGCCTCGGTGTGCTCACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152072896_1152072900 0 Left 1152072896 17:78142862-78142884 CCTTGAAGGAATCATCAAACTCT 0: 1
1: 0
2: 0
3: 26
4: 228
Right 1152072900 17:78142885-78142907 GGGCCTCGGTGTGCTCACCCAGG 0: 1
1: 0
2: 2
3: 20
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152072900 Original CRISPR GGGCCTCGGTGTGCTCACCC AGG Exonic
900357705 1:2272776-2272798 CGGCCTATGTGTGCTGACCCTGG + Intronic
902669628 1:17964093-17964115 GTGCCTCAGTGTCCTCATCCAGG - Intergenic
902958054 1:19940239-19940261 GGGCCTTGGTATGCTCTCCTGGG - Intergenic
904335374 1:29793880-29793902 TGGGCTCAGTTTGCTCACCCAGG + Intergenic
905887880 1:41501560-41501582 AGGCCTAGGTGTCATCACCCTGG + Intergenic
906186157 1:43863703-43863725 GGGCCTCTGTGGGGTCTCCCAGG - Intronic
906960217 1:50415603-50415625 GGGCCTGGGTGTGCGACCCCAGG + Intergenic
911219847 1:95234577-95234599 GGGCCTGGGGGTGCGCACGCAGG - Intronic
913978580 1:143487900-143487922 GCGCCTCGTGGCGCTCACCCTGG + Intergenic
914072991 1:144313548-144313570 GCGCCTCGTGGCGCTCACCCTGG + Intergenic
914106163 1:144652812-144652834 GCGCCTCGTGGCGCTCACCCTGG - Intergenic
914196625 1:145451190-145451212 GAGCCTCCGTGTTCTCACCTGGG - Intergenic
919816933 1:201447329-201447351 GGGCCTCACTCTGGTCACCCAGG - Intergenic
920037505 1:203075687-203075709 GGGCTTCCGTGTGTCCACCCTGG + Exonic
921148361 1:212380068-212380090 AGGCCTCTGTGTACTCTCCCAGG - Intronic
922875473 1:228936873-228936895 GGGCCTCTGTTTCCTCACCCAGG - Intergenic
1062817706 10:512891-512913 GGGTCTCGCTGTTGTCACCCAGG - Intronic
1069746503 10:70718042-70718064 GGGCCTTGGTGGCCTCAGCCTGG + Intronic
1069774584 10:70919115-70919137 GGGCCTCAGTGTTCTCATCTTGG - Intergenic
1069795399 10:71048725-71048747 GGGCCTAGGTGAGAGCACCCAGG + Intergenic
1070775776 10:79108930-79108952 GGGCCTGGGTGTGCCCACTCAGG - Intronic
1071727542 10:88215014-88215036 AGGCCTTGGTGTTCTCAGCCTGG - Intergenic
1074776410 10:116771072-116771094 GGGCCTCAGTTTGCAAACCCTGG + Intergenic
1075092265 10:119450504-119450526 GGGCCTCCGTGCGTGCACCCAGG + Intronic
1076464129 10:130666726-130666748 GGGCCCCGATCTGCTCACTCAGG - Intergenic
1077104549 11:836520-836542 GTGCCTTGCTGTGCTCACCTGGG + Intronic
1077373195 11:2193214-2193236 GGGCCTCAGTGTCCCCACCTGGG + Intergenic
1083610088 11:64000392-64000414 GGGACTGAGGGTGCTCACCCCGG - Intronic
1085619022 11:78023292-78023314 GAGCCTCGGTGTTCCCACCTAGG - Exonic
1089422836 11:118344438-118344460 GGGCCTGGCTGTCCTCATCCTGG + Exonic
1089561654 11:119346229-119346251 GGGCCTCTCTGTCCTCCCCCAGG + Intronic
1091572189 12:1696723-1696745 GGGCCTCTGTCAGCTTACCCTGG + Intronic
1096583116 12:52601168-52601190 GTCCCTCCGTGTGCCCACCCGGG - Exonic
1096654425 12:53079543-53079565 GGGCCCCGGTCTGGTCAACCCGG + Intergenic
1102240740 12:111323039-111323061 GAGCCTCCGTTTCCTCACCCGGG - Intronic
1102349373 12:112180829-112180851 AGACCTCGGTGGGCTCACCCTGG - Intronic
1103332317 12:120162856-120162878 GGGACTCTGTGTGGTCATCCTGG + Exonic
1103961020 12:124609404-124609426 GTGCCTCGGTTTGCTCATCTGGG + Intergenic
1105070477 12:133231542-133231564 GGGCGTGGCTGCGCTCACCCCGG - Exonic
1105220749 13:18323495-18323517 GCGCCTCGTGGCGCTCACCCTGG - Intergenic
1105949558 13:25217483-25217505 GGGCCTCATTGTGCTCATCTGGG - Intergenic
1106654950 13:31733297-31733319 GGGCCCCTGTGGGCTCAACCAGG + Intergenic
1111570218 13:90074087-90074109 GAGCCACCGTGTGCTCAGCCTGG + Intergenic
1112771749 13:102800312-102800334 GGGCCTCGGCGCGCTCCCCCTGG + Intronic
1113544467 13:111137406-111137428 AGGCCACGGTGTCCTCACCTGGG + Intronic
1113737851 13:112690614-112690636 GGGCCTCGGAGTTGACACCCTGG + Intronic
1113838244 13:113343622-113343644 GGCCTTCGGTGTCCTCACCCTGG + Intronic
1113927252 13:113948468-113948490 GGGCTTCGGTGTGCTCACACAGG - Intergenic
1113943720 13:114032534-114032556 GGGCTTCGGGGTGTGCACCCTGG - Intronic
1117286139 14:54287472-54287494 GAGCCTCCGTGTGCTTTCCCTGG - Intergenic
1121630319 14:95417025-95417047 GGGGCTCGGTGTCATCACCAGGG + Intronic
1122036026 14:98949987-98950009 AGGCCTCTGTGTGCTCACTGGGG + Intergenic
1122163418 14:99802817-99802839 GGGCACCGATGAGCTCACCCAGG + Intronic
1122842872 14:104475342-104475364 AGGCCTCGATGTGCACACGCAGG - Intronic
1123063961 14:105606834-105606856 GGGCCTAGGTGGGCACACGCCGG - Intergenic
1123073274 14:105652477-105652499 GGGCCTAGGTGGGCACACGCCGG - Intergenic
1123106457 14:105844051-105844073 TGGCCACGGTGCCCTCACCCTGG - Intergenic
1124340597 15:28886996-28887018 GGGCCTCGGTGTGCCCAGGCGGG + Intronic
1124983470 15:34584011-34584033 GGGCATCTGTGTGCTCCCCAGGG - Intronic
1125724316 15:41860623-41860645 GGGCCTCGGGGTGCCCACCCTGG + Exonic
1125731371 15:41894359-41894381 GGGCCTCTCTGTGAGCACCCAGG + Intergenic
1125935026 15:43627731-43627753 GGGTCTCGCTGTTGTCACCCAGG + Intergenic
1127555697 15:60085144-60085166 GGGCCTTGGTTTCCTCACCAGGG - Intergenic
1129673865 15:77621969-77621991 GGTCCTCTGGGTGCTCAGCCTGG + Intronic
1130438359 15:83925431-83925453 GGGCCTTGCTTTGCTCACCAAGG - Intronic
1131438822 15:92443348-92443370 CGGCCTGGGTGTGCACACCTGGG - Intronic
1132606747 16:796857-796879 GAGCCTGGGTGGGCTCACCTGGG - Exonic
1132757762 16:1494160-1494182 GGGTCTCGGGGCGCTCACCGAGG + Intronic
1133810297 16:9156188-9156210 GGGTCTCGCTGTTGTCACCCAGG - Intergenic
1134135394 16:11673639-11673661 GGGCCACTGTGTCCCCACCCTGG - Intronic
1135486706 16:22871889-22871911 GGGCCAGGGTGGGCTCACCTGGG + Intronic
1136332771 16:29591982-29592004 GGGTCTTGCTGTGGTCACCCAGG - Intergenic
1137984256 16:53094359-53094381 GGCCCTTGGTGTCCTCTCCCTGG - Intronic
1138543617 16:57703521-57703543 GGGTCCCTGGGTGCTCACCCAGG - Intronic
1138676795 16:58657192-58657214 GGGCCTCACTCTGGTCACCCAGG + Intergenic
1139477649 16:67210670-67210692 CGGCCTCCGTGAGCTCAACCTGG - Exonic
1141212801 16:81996662-81996684 GGGCTTAGGTGAGCTCACCTAGG + Exonic
1142116231 16:88357491-88357513 GGGCCTCGGTGGCATCAGCCAGG + Intergenic
1142135608 16:88450655-88450677 GGTCCTAGGTGGGCTCAGCCTGG + Intergenic
1142141875 16:88476172-88476194 GGGTCTCAGCCTGCTCACCCTGG - Intronic
1203113439 16_KI270728v1_random:1466922-1466944 GGGCCTTGGTTTTCTCATCCAGG + Intergenic
1142758146 17:2027842-2027864 GGGCCTCGGTGTACTTACAGAGG - Intergenic
1143273619 17:5693909-5693931 GGCCCTCTGTGTGCCCAGCCTGG + Intergenic
1144127792 17:12218938-12218960 GGGCCTCAGTTTGCTCATCTGGG + Intergenic
1147870520 17:43583877-43583899 GAGCCTGGGTGAGCTGACCCGGG - Intergenic
1150649144 17:66998656-66998678 GTGCCTGGCTGAGCTCACCCAGG + Intronic
1150649146 17:66998659-66998681 GGCCCTGGGTGAGCTCAGCCAGG - Intronic
1150701623 17:67452036-67452058 GGGTCTCACTGTGATCACCCAGG + Intronic
1151178480 17:72308610-72308632 GTGCCTCAGTGTCCTGACCCTGG - Intergenic
1151881230 17:76896014-76896036 GGGCCTTGGTGTTGTCACCGTGG - Intronic
1151920859 17:77154426-77154448 GGGCCTCGCTCTGTTCACACAGG - Intronic
1152072900 17:78142885-78142907 GGGCCTCGGTGTGCTCACCCAGG + Exonic
1152821139 17:82438485-82438507 GGGCCTCCGTGGCATCACCCTGG + Intronic
1157077616 18:44482686-44482708 GGGCCTCACTGTTCTCTCCCAGG + Intergenic
1160178917 18:76617844-76617866 GGGGCTAGGTGTCCTAACCCGGG - Intergenic
1160739896 19:680850-680872 GGGCCTCTGGGGGCTCACACTGG + Intronic
1160748176 19:721032-721054 GGGCCACGCTGTGCCCTCCCTGG + Intronic
1161910866 19:7192810-7192832 TTGCTTCTGTGTGCTCACCCAGG - Intronic
1162127120 19:8505781-8505803 GGGCCTTGGTGCGCGCGCCCTGG - Intergenic
1162571892 19:11479208-11479230 GGGCCTCGTGCTGTTCACCCAGG - Intronic
1162728781 19:12705474-12705496 GGGCCTAGGGTTGCTCACCATGG + Exonic
1163020462 19:14478508-14478530 GGGCCTCGGCCAGCTCATCCGGG + Exonic
1163188715 19:15659295-15659317 GGGGCTCGGTGTGGTCAGGCAGG - Exonic
1163216079 19:15878839-15878861 GGGGCTCGGTGTGGTCAGGCAGG + Exonic
1168523569 19:57071418-57071440 GGGCCTAGGGGGGCTAACCCAGG - Intergenic
925688328 2:6495167-6495189 GGGCCTCATGGAGCTCACCCTGG - Intergenic
926333182 2:11842345-11842367 GGGACTGGGTCTGTTCACCCAGG + Intergenic
932813874 2:74845976-74845998 GGGCACAGGTGTGCCCACCCTGG - Intronic
932824828 2:74929717-74929739 AGGCCTCGGTGAGGTCACCAGGG + Intergenic
933129070 2:78650814-78650836 GGGCCTCTGTGTGCCCAGGCTGG + Intergenic
934183306 2:89648980-89649002 GCGCCTCGTGGCGCTCACCCTGG + Intergenic
934293588 2:91723151-91723173 GCGCCTCGTGGCGCTCACCCTGG + Intergenic
936069124 2:109353616-109353638 GTGCCTCTGTCTCCTCACCCAGG + Intronic
936092582 2:109510767-109510789 GGGCCCCACTCTGCTCACCCTGG - Intergenic
937907776 2:127060786-127060808 GGGCCTGGGCGTGCTATCCCGGG + Intronic
937982430 2:127623420-127623442 GAGCCTCAGGGTGCTCTCCCTGG - Intronic
941089080 2:161153659-161153681 GGGCCTCACTGTTGTCACCCAGG - Intronic
942533567 2:176938837-176938859 TGGCCTCGGTCTGATCACCCAGG - Intergenic
948569785 2:238910719-238910741 AGGCCTCGGTCTGTTCACACTGG - Intergenic
1168805028 20:667471-667493 GGGCCTCTGTTTCCTCACCCGGG + Intronic
1169561963 20:6811266-6811288 GGGAAGCGGTGTGCTCAGCCAGG - Intergenic
1170684863 20:18560328-18560350 GGGCCTCCGTGAGCTCACAGTGG + Intronic
1172624200 20:36337947-36337969 GGGCCTCGGCTTCCTCATCCTGG - Intronic
1172978314 20:38922609-38922631 GGGCCTGGCTCTGCACACCCAGG + Exonic
1174035643 20:47666667-47666689 GGGCCTCGAGGTGATCACACCGG + Intronic
1174690451 20:52499085-52499107 GGGCCATGGTTTGCTGACCCTGG - Intergenic
1176187020 20:63786095-63786117 GGGCCTCGCTGTGCTGACAACGG + Intronic
1176918949 21:14663386-14663408 GGGCACCAGTGTGCTCACCCTGG + Intergenic
1178303428 21:31471191-31471213 GGGCTTCGTTGTGCCCACCTGGG - Intronic
1178953794 21:37006295-37006317 GGGCCTCGCTTTCCTCTCCCGGG + Intronic
1179522839 21:41956310-41956332 GGCCCTCGGATTCCTCACCCCGG - Intergenic
1180081762 21:45490476-45490498 GGGCCTCCGTGTGCCCTCCCGGG + Intronic
1180081782 21:45490534-45490556 GGGCCTCCGTGTGCCCTCCTGGG + Intronic
1180081797 21:45490582-45490604 GGGCCTCCGTGTGCCCTCCCGGG + Intronic
1180081808 21:45490610-45490632 GGGCCTTCGTGTGCCCTCCCAGG + Intronic
1181431120 22:22882475-22882497 GGCCCTCCCTGTGCTCACCCTGG + Intronic
1181457165 22:23066367-23066389 GGGCCTCAGTTTCCTCACCAAGG - Intronic
1182280994 22:29217615-29217637 CAGCCTCAGTGTCCTCACCCGGG + Intronic
1182472994 22:30560115-30560137 GGGCCTCACTCTGGTCACCCAGG - Intronic
1183452857 22:37906255-37906277 GGGCCGCGGTGTCCTCGCTCGGG - Intronic
1184345726 22:43911531-43911553 AGGCCTCTGTGTTCACACCCAGG + Intergenic
1185029119 22:48432382-48432404 GGGCCTCGATGCGCCCAGCCTGG + Intergenic
1185251435 22:49803814-49803836 GGGACCCGGTGAGCACACCCGGG - Intronic
1185340658 22:50289490-50289512 GGGCCTCAGTGTGTTCTCGCAGG - Intronic
949866243 3:8549832-8549854 GGGGCTGGGTGTGCTAACTCGGG + Intronic
951563334 3:23989241-23989263 GGGCCTAGGTCTGCGCACCATGG + Intergenic
953675418 3:44997857-44997879 GGGCCTCTGGGGCCTCACCCAGG - Intronic
954087852 3:48260161-48260183 GGGTCTCGCTCTGGTCACCCAGG + Intronic
954324737 3:49857303-49857325 GGGCCTGGGTGAACTCACCAGGG - Intergenic
960844398 3:121993372-121993394 GTGCCTCTGAGTGCTCTCCCGGG + Exonic
961889643 3:130119879-130119901 GTGCCTAGGCGGGCTCACCCGGG + Intergenic
968224706 3:196966547-196966569 GGGCCCCAGTGGGCCCACCCAGG - Intronic
968508483 4:983523-983545 GGGCCTCGCTGGGCTCCCCCAGG + Intronic
968831310 4:2934181-2934203 GGTCCGCGATGTGCTCACCCTGG - Exonic
969429589 4:7146334-7146356 GGGCCTCCGTGTCCTCCGCCCGG - Intergenic
969676972 4:8619636-8619658 GGGCCTCGGTCTCCACATCCTGG - Exonic
972203432 4:36743132-36743154 GGGGCTGGGTATGCTCACTCAGG - Intergenic
984719044 4:182953149-182953171 GTGGCTCAGTGTGCCCACCCAGG - Intergenic
985651476 5:1109686-1109708 GGGCCTTGGTGTCCCCAGCCTGG - Intronic
985671075 5:1206968-1206990 CGGCTTCGCTGTGCTCACCCCGG + Intronic
985721014 5:1489073-1489095 GGGCCGGCGTGGGCTCACCCTGG + Intronic
987218996 5:15770242-15770264 GGGCCCCAGTGTGCCCAGCCTGG + Intronic
989105907 5:37862636-37862658 GGGCTTCTGTCTGCTCCCCCGGG - Intergenic
1000362994 5:160465589-160465611 GAGTCTCGCTGTGGTCACCCAGG + Intergenic
1006592551 6:35169102-35169124 GGGCCTTGGTGTCCACACACAGG + Intergenic
1007416847 6:41695987-41696009 GCCACTCGGTGTCCTCACCCAGG - Intronic
1014019180 6:116567979-116568001 GGGGCTGAGTGTGCTCACTCAGG - Intergenic
1017547738 6:155469788-155469810 GGGCAGCAGTGTGCTCAGCCTGG + Intergenic
1019281175 7:200995-201017 GAGCCTGGGTGTGGGCACCCGGG + Intronic
1019335527 7:480862-480884 GGGACTGGGTGAGCTCAGCCTGG - Intergenic
1019406335 7:886065-886087 GGGCCTCCGTGTGCTTGCTCTGG - Exonic
1019577076 7:1742695-1742717 GGGCCTCGGGGAGCTAACCCAGG - Intronic
1021633092 7:22665482-22665504 GGGGCTGGGTGTGCTCGGCCTGG + Intergenic
1023916787 7:44595946-44595968 GGGCCTCGCTTTTGTCACCCAGG - Intergenic
1026780959 7:73267015-73267037 GGTCCTCGGTTTGCTCCCCAAGG + Intergenic
1027021813 7:74820457-74820479 GGTCCTCGGTTTGCTCCCCAAGG + Intronic
1027066208 7:75125460-75125482 GGTCCTCGGTTTGCTCCCCAAGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030834505 7:114265698-114265720 GGGCTTCTGTGTGTGCACCCAGG + Intronic
1035129556 7:156640031-156640053 GGGCCACGCAGGGCTCACCCGGG + Exonic
1037835482 8:22212700-22212722 TGGCCCCCGTGTGCTCACCTAGG - Intergenic
1039557563 8:38487594-38487616 GGGCCTCAGTTTTCTCACCTAGG - Intergenic
1040618638 8:49064562-49064584 GGGCCTCGGTGGGCTTGTCCTGG - Intronic
1044691929 8:94889120-94889142 GAGCCTCGCTGTTGTCACCCAGG - Intronic
1048109661 8:131454031-131454053 GGGACAGGGTGTGCTCACCCTGG - Intergenic
1048254719 8:132896981-132897003 GAGCCTCTGTGTCCTCACCTGGG + Intronic
1056573042 9:87832965-87832987 GGGCCTAGCTGTGGTCACTCTGG + Intergenic
1056992422 9:91423964-91423986 GGGCCGCGGAGTGCCCGCCCCGG - Intergenic
1057314187 9:93958452-93958474 GGGCCTCGGTGTCCTCGACAGGG - Intergenic
1060200992 9:121651728-121651750 GGGCCTGGGCGCGCTCACACGGG - Intronic
1060770079 9:126326538-126326560 GGGCCCCGGTGCGCCCACCCGGG - Intergenic
1061205611 9:129161377-129161399 GGGCAGTGGTGTGCTCACACTGG + Intergenic
1061486597 9:130923542-130923564 GGGACTCTGTGAGCTGACCCTGG - Intronic
1062295788 9:135825795-135825817 AGGCCTAGGTGTGCTGACTCTGG - Intronic
1062337303 9:136077679-136077701 GGGCAGCTGTGTGGTCACCCGGG + Intronic
1062424342 9:136499094-136499116 GTGCCCCCGTGGGCTCACCCAGG + Exonic
1062621081 9:137422960-137422982 GGGCCTCAGTTTCCCCACCCCGG + Intronic
1062698107 9:137885644-137885666 GAGCCTCCGTGTTCTCACCTGGG + Intronic
1186366456 X:8899618-8899640 GGGTCTTGCTGTGCTCACCCAGG + Intergenic
1190337945 X:49274172-49274194 GAGCCTCAGTTTGCTCATCCAGG - Intronic
1193795677 X:85869865-85869887 GTGACTTGGTGTGCTCACACTGG + Intronic
1195688474 X:107605312-107605334 GGCCCTTTGTGTGCTCATCCTGG + Intergenic
1197635210 X:128906909-128906931 TGGCCTCGAAGTGCTCATCCAGG - Intergenic
1198727516 X:139692461-139692483 GGGCGTGGGTGTGCGCACCCAGG - Intronic
1199698963 X:150362882-150362904 GGGCATCGGTGCACTCACCTTGG - Intronic
1200218720 X:154380182-154380204 GGGCATCGGTGTGCCCCGCCTGG - Intronic