ID: 1152073263

View in Genome Browser
Species Human (GRCh38)
Location 17:78144529-78144551
Sequence CTGCTGAAGGCGGGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152073263_1152073270 -4 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073263_1152073275 7 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073275 17:78144559-78144581 AACAGACTTTGGGAAGGGAAGGG No data
1152073263_1152073273 2 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073273 17:78144554-78144576 GTGAGAACAGACTTTGGGAAGGG No data
1152073263_1152073274 6 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073263_1152073272 1 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073272 17:78144553-78144575 AGTGAGAACAGACTTTGGGAAGG No data
1152073263_1152073271 -3 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073271 17:78144549-78144571 CAGAAGTGAGAACAGACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152073263 Original CRISPR CTGCTGAAGGCGGGTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr