ID: 1152073268

View in Genome Browser
Species Human (GRCh38)
Location 17:78144539-78144561
Sequence GTTCTCACTTCTGCTGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152073268_1152073273 -8 Left 1152073268 17:78144539-78144561 CCGCCTTCAGCAGAAGTGAGAAC No data
Right 1152073273 17:78144554-78144576 GTGAGAACAGACTTTGGGAAGGG No data
1152073268_1152073272 -9 Left 1152073268 17:78144539-78144561 CCGCCTTCAGCAGAAGTGAGAAC No data
Right 1152073272 17:78144553-78144575 AGTGAGAACAGACTTTGGGAAGG No data
1152073268_1152073275 -3 Left 1152073268 17:78144539-78144561 CCGCCTTCAGCAGAAGTGAGAAC No data
Right 1152073275 17:78144559-78144581 AACAGACTTTGGGAAGGGAAGGG No data
1152073268_1152073274 -4 Left 1152073268 17:78144539-78144561 CCGCCTTCAGCAGAAGTGAGAAC No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152073268 Original CRISPR GTTCTCACTTCTGCTGAAGG CGG (reversed) Intergenic
No off target data available for this crispr