ID: 1152073269

View in Genome Browser
Species Human (GRCh38)
Location 17:78144542-78144564
Sequence TCTGTTCTCACTTCTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152073269_1152073274 -7 Left 1152073269 17:78144542-78144564 CCTTCAGCAGAAGTGAGAACAGA No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073269_1152073275 -6 Left 1152073269 17:78144542-78144564 CCTTCAGCAGAAGTGAGAACAGA No data
Right 1152073275 17:78144559-78144581 AACAGACTTTGGGAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152073269 Original CRISPR TCTGTTCTCACTTCTGCTGA AGG (reversed) Intergenic
No off target data available for this crispr