ID: 1152073270

View in Genome Browser
Species Human (GRCh38)
Location 17:78144548-78144570
Sequence GCAGAAGTGAGAACAGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152073266_1152073270 -10 Left 1152073266 17:78144535-78144557 CCACCCGCCTTCAGCAGAAGTGA No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073264_1152073270 -8 Left 1152073264 17:78144533-78144555 CCCCACCCGCCTTCAGCAGAAGT No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073261_1152073270 13 Left 1152073261 17:78144512-78144534 CCTTCAGTCTTCAGTTCCCTTCC No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073262_1152073270 -3 Left 1152073262 17:78144528-78144550 CCCTTCCCCACCCGCCTTCAGCA No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073258_1152073270 30 Left 1152073258 17:78144495-78144517 CCAGTGACCTCTGGCTCCCTTCA No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073265_1152073270 -9 Left 1152073265 17:78144534-78144556 CCCACCCGCCTTCAGCAGAAGTG No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073260_1152073270 14 Left 1152073260 17:78144511-78144533 CCCTTCAGTCTTCAGTTCCCTTC No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073259_1152073270 23 Left 1152073259 17:78144502-78144524 CCTCTGGCTCCCTTCAGTCTTCA No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data
1152073263_1152073270 -4 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073270 17:78144548-78144570 GCAGAAGTGAGAACAGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152073270 Original CRISPR GCAGAAGTGAGAACAGACTT TGG Intergenic
No off target data available for this crispr