ID: 1152073274

View in Genome Browser
Species Human (GRCh38)
Location 17:78144558-78144580
Sequence GAACAGACTTTGGGAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152073261_1152073274 23 Left 1152073261 17:78144512-78144534 CCTTCAGTCTTCAGTTCCCTTCC No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073268_1152073274 -4 Left 1152073268 17:78144539-78144561 CCGCCTTCAGCAGAAGTGAGAAC No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073267_1152073274 -3 Left 1152073267 17:78144538-78144560 CCCGCCTTCAGCAGAAGTGAGAA No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073269_1152073274 -7 Left 1152073269 17:78144542-78144564 CCTTCAGCAGAAGTGAGAACAGA No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073263_1152073274 6 Left 1152073263 17:78144529-78144551 CCTTCCCCACCCGCCTTCAGCAG No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073260_1152073274 24 Left 1152073260 17:78144511-78144533 CCCTTCAGTCTTCAGTTCCCTTC No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073264_1152073274 2 Left 1152073264 17:78144533-78144555 CCCCACCCGCCTTCAGCAGAAGT No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073262_1152073274 7 Left 1152073262 17:78144528-78144550 CCCTTCCCCACCCGCCTTCAGCA No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073266_1152073274 0 Left 1152073266 17:78144535-78144557 CCACCCGCCTTCAGCAGAAGTGA No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data
1152073265_1152073274 1 Left 1152073265 17:78144534-78144556 CCCACCCGCCTTCAGCAGAAGTG No data
Right 1152073274 17:78144558-78144580 GAACAGACTTTGGGAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152073274 Original CRISPR GAACAGACTTTGGGAAGGGA AGG Intergenic
No off target data available for this crispr