ID: 1152077677

View in Genome Browser
Species Human (GRCh38)
Location 17:78169093-78169115
Sequence AGCCACGTGGGGTAAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152077664_1152077677 13 Left 1152077664 17:78169057-78169079 CCAGATTGGGGAGTTCACCGGGA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 214
1152077655_1152077677 30 Left 1152077655 17:78169040-78169062 CCCGCACGCCGCGACTCCCAGAT 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 214
1152077668_1152077677 -4 Left 1152077668 17:78169074-78169096 CCGGGACGGGGTTTTCCGAAGCC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 214
1152077662_1152077677 14 Left 1152077662 17:78169056-78169078 CCCAGATTGGGGAGTTCACCGGG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 214
1152077656_1152077677 29 Left 1152077656 17:78169041-78169063 CCGCACGCCGCGACTCCCAGATT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 214
1152077660_1152077677 22 Left 1152077660 17:78169048-78169070 CCGCGACTCCCAGATTGGGGAGT 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152077677 Original CRISPR AGCCACGTGGGGTAAGGGAG GGG Intronic
900365843 1:2311649-2311671 AGCCACGTGGGGGCAGGGAGGGG + Intergenic
900585880 1:3432158-3432180 GGCCAGGTGGGGTGGGGGAGGGG - Intronic
902794945 1:18794961-18794983 AGCCACATGGGGTGTGGAAGGGG - Intergenic
902798386 1:18814521-18814543 GGCGACTTGGGGTTAGGGAGGGG - Intergenic
903023415 1:20410376-20410398 TCCTAAGTGGGGTAAGGGAGGGG - Intergenic
904334558 1:29788169-29788191 AGCCACGGGAGGCCAGGGAGGGG - Intergenic
905028261 1:34865708-34865730 AGCCCCGCGGGGTGGGGGAGGGG + Exonic
905853189 1:41289437-41289459 AGGCAGGTGTGGTAAGAGAGTGG + Intergenic
906046874 1:42837958-42837980 AACAGTGTGGGGTAAGGGAGAGG + Intronic
906137724 1:43511460-43511482 AGCCACATGGAATGAGGGAGAGG - Intergenic
906329187 1:44870458-44870480 GGACATGTGGGGTAAGGGAGAGG - Intronic
906552977 1:46681626-46681648 AGCCACTTGGTGTAAGGCATTGG - Intronic
908327356 1:63036269-63036291 AGCAGCTTGGGGTAAGGAAGGGG - Intergenic
909931815 1:81505459-81505481 AGCTGCCTGGGGAAAGGGAGAGG - Intronic
911989485 1:104675023-104675045 AGCAAGGTGGGATAATGGAGAGG - Intergenic
915194637 1:154180398-154180420 AGACACCTGTGGGAAGGGAGGGG - Intronic
918147039 1:181766115-181766137 TGCCACTTTGGGTATGGGAGTGG + Intronic
918215965 1:182392007-182392029 GGCGGCGTGGGGGAAGGGAGCGG + Exonic
919920985 1:202166277-202166299 AGCCAGGTGGGGGTTGGGAGGGG + Intergenic
922580684 1:226695656-226695678 AGCCACGTTCTGTAGGGGAGGGG - Intronic
922880912 1:228979634-228979656 AGCCCAGTGGGGGAAGGGACTGG + Intergenic
1064259992 10:13777747-13777769 AGACGCTTGGGGAAAGGGAGAGG - Intronic
1066532889 10:36359591-36359613 AGCCAGGAAGGGTAAGGGAAGGG - Intergenic
1067016053 10:42756822-42756844 AGACACATGGGGGAGGGGAGGGG + Intergenic
1070359173 10:75670832-75670854 AGTCCCCTGAGGTAAGGGAGCGG - Intronic
1070675324 10:78407923-78407945 AGCTAGGTGAGGTAAGTGAGGGG - Intergenic
1071471411 10:85986577-85986599 AGCCACATTGGAGAAGGGAGTGG + Intronic
1073401099 10:103258335-103258357 AGCCTTGTGCAGTAAGGGAGGGG - Intergenic
1075330503 10:121570435-121570457 AGCCTGGTGGAGTCAGGGAGAGG - Intronic
1076568253 10:131413375-131413397 AGCCACGTGGGGTGGTGGAAGGG - Intergenic
1077485737 11:2837652-2837674 AACCAGGAGGGGGAAGGGAGGGG + Intronic
1077999011 11:7478203-7478225 GACCACTTGGGGTGAGGGAGAGG - Intergenic
1078065990 11:8080100-8080122 AGCCAAGGGGGCTGAGGGAGGGG - Intronic
1078840469 11:15072672-15072694 AGCGAAGTGGGGTAGGGGTGTGG + Intronic
1079283251 11:19106761-19106783 AACCACTTAGGGTAAGGGAGAGG + Intergenic
1083299847 11:61734608-61734630 AGCCAGGTGGGGAGAGGGAAGGG + Intronic
1086038049 11:82440644-82440666 AGTAACGTGGGAAAAGGGAGGGG + Intergenic
1089001770 11:115057929-115057951 AGACACATGGGGTAAGGGTTTGG - Intergenic
1090260270 11:125314367-125314389 AGCCAGGGTGGGTCAGGGAGGGG + Intronic
1090419663 11:126565747-126565769 AGTGAAGTGGGGGAAGGGAGGGG + Intronic
1091983284 12:4884112-4884134 AGCCAGATTGGGTAAGAGAGAGG + Intergenic
1092016217 12:5161099-5161121 AGACACCTGGGGAAGGGGAGGGG - Intergenic
1093303211 12:17479059-17479081 AGCCACACGGGGCAGGGGAGTGG + Intergenic
1095962155 12:47842376-47842398 AGCCACCTGGGGAATGAGAGTGG + Intronic
1096179049 12:49540599-49540621 AGCAATGTGGGGTAAGGGCTGGG - Intronic
1096529520 12:52234144-52234166 AGGCAGGTGGGGGAGGGGAGGGG - Intronic
1096806392 12:54143665-54143687 AGCAACAAGGGGAAAGGGAGTGG + Intergenic
1098435984 12:70468512-70468534 AGCCCCTGGAGGTAAGGGAGAGG - Intergenic
1099826853 12:87786996-87787018 AGACACGTGGGGGAAAGGAAAGG - Intergenic
1100461851 12:94807767-94807789 AGCCACATAGGGTCAGGGAAAGG - Intergenic
1103103146 12:118198246-118198268 AGCCAGCTGGGGTAAGAGATGGG - Intronic
1103685779 12:122730908-122730930 TGCCCCGTGGGATGAGGGAGAGG - Intergenic
1104825026 12:131701941-131701963 AGCCACGTGGGCCACGGGGGTGG - Intergenic
1106416851 13:29553020-29553042 AGCCAAGTGGGGCAGGGGGGCGG - Intronic
1109680605 13:65747531-65747553 AGCCTGGAGGGATAAGGGAGAGG - Intergenic
1112409574 13:99151120-99151142 AGCACCGTGGGGGAAGGCAGAGG + Intergenic
1113348106 13:109500340-109500362 AGCCACCAGGGGCAGGGGAGTGG + Intergenic
1113606718 13:111613165-111613187 CCCCACGTGGGCTAAGGCAGTGG - Intronic
1114069426 14:19095978-19096000 AGACACATGGGGGAGGGGAGGGG - Intergenic
1114092836 14:19304025-19304047 AGACACATGGGGGAGGGGAGGGG + Intergenic
1114453694 14:22842378-22842400 AGCCACGTGGGGAGAGGATGGGG - Intronic
1116176776 14:41480986-41481008 AACCACATGAGGTAATGGAGTGG - Intergenic
1117041751 14:51774575-51774597 AGCCATGGGGGGCAAGGGGGTGG + Intergenic
1118136949 14:63039888-63039910 AGCAAGGTGGGGGAAGGGGGAGG + Intronic
1118466808 14:66038559-66038581 ATCTATGTGGGGGAAGGGAGGGG + Intergenic
1119703634 14:76771015-76771037 AGCCAAGGAGGGTGAGGGAGAGG + Intronic
1120846173 14:89126927-89126949 GGCCACGTGGGGTAAGAAAGGGG + Intronic
1121790871 14:96698777-96698799 GGCCAGGTGGGCTCAGGGAGTGG + Intergenic
1122813936 14:104303126-104303148 AGCCACGTGGGGTCGAGGATTGG + Intergenic
1125691643 15:41600721-41600743 AGCTGCCTGGGGAAAGGGAGAGG + Intergenic
1129295476 15:74597764-74597786 AGCTGCCTGGGGAAAGGGAGAGG - Exonic
1129869976 15:78933899-78933921 AGCCGGCTGGGCTAAGGGAGCGG - Intronic
1129948505 15:79563099-79563121 AGCCACCTGGGAGCAGGGAGAGG + Intergenic
1132984422 16:2756836-2756858 AGGCACGTGGGAGAAGGGAGGGG + Intronic
1134176491 16:12011083-12011105 AAGTACTTGGGGTAAGGGAGGGG - Intronic
1135572976 16:23563428-23563450 AACCATCTGGGGGAAGGGAGAGG - Intronic
1136234576 16:28905798-28905820 GGCTAGGTGGGGAAAGGGAGAGG - Intronic
1137481515 16:48855659-48855681 AGCCATGTGGGGTAGAGGAAAGG - Intergenic
1138026075 16:53523459-53523481 ACCCAGGTGAGGGAAGGGAGTGG - Intergenic
1138098188 16:54230155-54230177 AGCCACGTGGGCTGGGGGAAGGG + Intergenic
1138180070 16:54935181-54935203 AGCCACTTGGGGGAAGAGAGGGG + Intergenic
1139328374 16:66169074-66169096 AGAGATGTGGGGTAGGGGAGAGG - Intergenic
1139526958 16:67522738-67522760 AGCCATGTGGGCTAGAGGAGAGG - Intronic
1139618760 16:68119462-68119484 AGCTACGGGTGGTCAGGGAGAGG - Intronic
1140214229 16:72994574-72994596 ATCCACCTGGGGAAAGGTAGAGG - Intronic
1140478973 16:75252374-75252396 AGCGACATGGGGTAGGAGAGCGG + Intronic
1143495105 17:7308103-7308125 GGCCACGTGAGGTGGGGGAGGGG + Intronic
1143651773 17:8267686-8267708 AGGAATGTGGGGGAAGGGAGTGG - Intronic
1144449552 17:15364704-15364726 AGCCTCGTGAGGTCAGGGAGGGG + Intergenic
1144891070 17:18494678-18494700 AGCTGCGTGGGGGATGGGAGGGG - Exonic
1145141153 17:20449640-20449662 AGCTGCGTGGGGGATGGGAGGGG + Intronic
1145794771 17:27649293-27649315 AGCTGCGTGGGGGATGGGAGGGG - Exonic
1145809266 17:27755011-27755033 AGCTGCGTGGGGGATGGGAGGGG - Intergenic
1145864270 17:28230107-28230129 TGGCAAGTGGGGGAAGGGAGAGG + Intergenic
1146269143 17:31473067-31473089 AGGCACGTGAGGTGGGGGAGTGG + Intronic
1146404453 17:32525243-32525265 ATCCACGTGGGGAAGGAGAGAGG - Intronic
1149172048 17:53823308-53823330 AGCCAAGGGGGATAAGGGCGGGG - Exonic
1151370486 17:73643990-73644012 CCCCACGTGGGGACAGGGAGGGG - Intronic
1151435937 17:74097464-74097486 AACCAAGTAGGGGAAGGGAGAGG + Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1151556279 17:74848254-74848276 ATCCACGTGGGGCCAGGCAGGGG - Intronic
1151763576 17:76121341-76121363 AGCCAGGAGGGGTGAGGGAGAGG - Intronic
1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG + Intronic
1152356371 17:79809668-79809690 AGCCAGGTGGTGGAAGGGAGAGG - Intergenic
1152538915 17:80965108-80965130 AGCCCCGTGGATTAAGGCAGGGG - Exonic
1152559784 17:81072194-81072216 AGCCATCTGGGAAAAGGGAGTGG - Intronic
1153496613 18:5705774-5705796 AGCCAAGTGGGGTTGGGCAGAGG - Intergenic
1154397191 18:14001598-14001620 AGCCAGGTGAGGTGAGGCAGAGG - Intergenic
1156334976 18:36162210-36162232 AGGCAGGAGGGGAAAGGGAGAGG - Intronic
1157433771 18:47651720-47651742 AGCCACCTGGGCTATAGGAGGGG + Intergenic
1158304622 18:56091192-56091214 AGCCACGTGGTGTAAGAGATAGG - Intergenic
1158405123 18:57153796-57153818 AGCCACGAGGGAGGAGGGAGAGG - Intergenic
1158889836 18:61862654-61862676 AGACACGTGGGGTGAGGGGTGGG - Intronic
1159041791 18:63331102-63331124 AGCTACGAGGGGGACGGGAGAGG - Exonic
1160575079 18:79848668-79848690 AGCCGCGTGGGGGAAGGAGGTGG + Intergenic
1160869997 19:1273344-1273366 AGCCAGGCGGGGGACGGGAGCGG + Intronic
1161211433 19:3068087-3068109 GGACACGTGGGGTCAGGGACGGG - Intergenic
1163334517 19:16661860-16661882 AGCACCGTGGGGGAAGGGAGGGG - Intronic
1163469036 19:17486314-17486336 AGCCAGCTGGGGTATGGGGGAGG + Intronic
1163598079 19:18231972-18231994 AGCAGGGTGGGGTGAGGGAGTGG + Intronic
1163844060 19:19628616-19628638 AGCCAAGTCGGATCAGGGAGTGG - Exonic
1167521701 19:49959436-49959458 AGCTGCGTGGGGTAAGGGCCGGG - Exonic
1167523682 19:49971286-49971308 AGCTGCGTGGGGTAAGGGCCGGG + Intergenic
1167622371 19:50567238-50567260 AGCCTAGTGGGGTCAGGGAACGG + Intronic
1167824699 19:51961538-51961560 AGCAAGGTGGAGTATGGGAGAGG + Intergenic
925596576 2:5561336-5561358 TGCCACATGGGGAAAGGGAGGGG + Intergenic
927898085 2:26798209-26798231 AGACACGTGGGGTGAGGTATGGG - Intronic
934050037 2:88202149-88202171 ACCCACGAGGGCTTAGGGAGCGG - Intergenic
936517046 2:113187486-113187508 TGCTAGGTGGGGGAAGGGAGAGG - Intronic
936517513 2:113191837-113191859 TGCTAGGTGGGGGAAGGGAGAGG + Intronic
937135231 2:119545929-119545951 AGCCATGTGTGGGAATGGAGTGG + Intronic
937750487 2:125471262-125471284 AGTCACGTGGGCTAAGGGCTGGG + Intergenic
938076226 2:128340032-128340054 AGACACGGGAGGGAAGGGAGAGG + Intergenic
938804853 2:134796641-134796663 AGCCACGTGGACTGAGAGAGGGG + Intergenic
939353351 2:141069555-141069577 AGGGACGTGGAGTAAGGAAGGGG - Intronic
942352240 2:175065120-175065142 AGCAACCTGGGGTTAGGGAAGGG - Intergenic
943575907 2:189630866-189630888 AGTCACCTGTGGTCAGGGAGGGG - Intergenic
946030148 2:216697125-216697147 AGCCACGTGGTGGCTGGGAGAGG + Intergenic
948155523 2:235778170-235778192 AGCCACAGGGAGGAAGGGAGGGG - Intronic
948243111 2:236455176-236455198 AGCCACGTGGTGCAGAGGAGTGG - Intronic
948585860 2:239019198-239019220 ACCCATGTGGGGGCAGGGAGGGG + Intergenic
948750919 2:240132476-240132498 AGCCACGGCCGGTCAGGGAGGGG - Intronic
948858140 2:240740185-240740207 GGCTACGTAGGGTGAGGGAGGGG + Intronic
948974859 2:241457858-241457880 AGCCACCTGGGGCGAGGGGGCGG + Intronic
1169752821 20:9012283-9012305 AGCCATGTGGGGTAGGGGAGAGG - Intergenic
1170780836 20:19423902-19423924 AGCCTGGAGGGGTAGGGGAGGGG + Intronic
1172096715 20:32464012-32464034 AGCCAGGCGGGGGATGGGAGGGG + Intronic
1172155353 20:32820151-32820173 AGCCGGGTGGGGGAAGGGCGGGG + Intronic
1175320439 20:58083410-58083432 AACCACATTGGGCAAGGGAGGGG - Intergenic
1175800462 20:61798330-61798352 AGGCCCGTGGGGCCAGGGAGAGG - Intronic
1175927765 20:62479431-62479453 AGCAACGTAGGGGAAGGGACAGG - Intergenic
1176023595 20:62974814-62974836 GGCCATGTGGGGTACAGGAGGGG + Intergenic
1179568615 21:42264753-42264775 GGCCACATGGGGAAAGGGGGAGG + Intronic
1179578617 21:42323310-42323332 TGCCACAGGGGGTAAGGGTGGGG - Intergenic
1179657694 21:42855370-42855392 AGCCAGGTGGGGCAGGGGTGGGG - Intronic
1179881631 21:44295520-44295542 AGCTGCCTGGGGTTAGGGAGGGG - Intronic
1180487896 22:15818541-15818563 AGACACATGGGGGAGGGGAGGGG - Intergenic
1181627302 22:24130648-24130670 AGGCTGGTGGGGTAGGGGAGGGG - Intronic
1183241166 22:36659299-36659321 GGCCACGTGGAGTCAGGGAGTGG + Intronic
1184482527 22:44756216-44756238 GGCCAGGTAGGGGAAGGGAGCGG - Intronic
1184488509 22:44795850-44795872 TGCCACCTGGGGTGGGGGAGGGG - Intronic
1185098596 22:48825522-48825544 AGTCACGTGGGGTGGGTGAGAGG + Intronic
1185271381 22:49930748-49930770 AGGCACGGGTGGTAAAGGAGGGG - Intergenic
951543965 3:23806978-23807000 AGCCCCGGGGGGCGAGGGAGGGG + Intronic
952842799 3:37662432-37662454 AGCCAGGGTGGGGAAGGGAGAGG + Intronic
953930271 3:47002524-47002546 TGCCACCCGGGGTAAGGGATGGG + Intronic
954363271 3:50133604-50133626 AGGCAGGTGGGGGCAGGGAGGGG - Intergenic
955317384 3:57950008-57950030 AGCCACGTGGGCTGGGGGTGGGG + Intergenic
956603160 3:71045004-71045026 AGCCACTTGAGGTGAGGGAGTGG + Intronic
956957039 3:74353064-74353086 AGCCAGGTAGTGTAAGGGAAGGG + Intronic
959525524 3:107372394-107372416 TGACACGTGGGGTAAGGGAAAGG - Intergenic
961457841 3:127033051-127033073 AGCCATGTGGGGTCAGGGGTGGG + Intronic
961661191 3:128469618-128469640 AGCCCCGTGGGTGAATGGAGAGG - Intergenic
961871082 3:129988663-129988685 GGCCGGGTGGGGCAAGGGAGGGG - Intergenic
964674156 3:159258840-159258862 AGCCACCTGGGGTCAGGCTGGGG - Intronic
966891068 3:184407939-184407961 ATCCAAGTAGGGTAAGGAAGTGG + Intronic
968901044 4:3431956-3431978 GGCCACGTGTGGCATGGGAGGGG + Intronic
968970581 4:3791544-3791566 ACTCAGGTGGGGTAAGGGAGGGG - Intergenic
969063597 4:4459719-4459741 AGCCAGATGGGGAGAGGGAGAGG + Intronic
969603330 4:8189598-8189620 AACCAGGTGGGGAAAGAGAGGGG + Intronic
971137790 4:23888825-23888847 GGGCACGTAGGGTAAGGGGGAGG - Intronic
975207366 4:71660746-71660768 AGCCAACTGAGGCAAGGGAGTGG + Intergenic
975536256 4:75454328-75454350 AGCCAAGTGGGGTAAGGAGGTGG + Intergenic
977776583 4:100928154-100928176 AGCCATGTGTGGTAAAGGATGGG - Intergenic
980107506 4:128601573-128601595 AGCCACGGGGGGTGAGGTGGGGG + Intergenic
985205499 4:187530963-187530985 GGCCATGTGGGGAAAGGGAAGGG - Intergenic
990534945 5:56712152-56712174 AGCAGTGTGGGGTAAGGAAGTGG - Intergenic
991925264 5:71698865-71698887 AGCCAGCTGGGGTAAAGGGGTGG + Intergenic
992164358 5:74034569-74034591 AGTCACTTGGGGCAAGGCAGGGG - Intergenic
993989526 5:94638671-94638693 TGCCAACTTGGGTAAGGGAGAGG + Intronic
996759465 5:126972694-126972716 AGCTACGTGGAGGAAGAGAGTGG + Intronic
997994572 5:138575412-138575434 AACCACGTGGGGTGAGGGGCGGG + Exonic
998230383 5:140357763-140357785 AGCCACTGGGCCTAAGGGAGCGG + Intergenic
998684305 5:144506227-144506249 AGGCACATGGGGTCAGGCAGGGG - Intergenic
999399056 5:151250368-151250390 AGTCAAGTGGGGGAAGGGAAGGG + Intronic
999997902 5:157109850-157109872 AGCCTCTTGGGGTAGGGGAGAGG - Intronic
1001769913 5:174286688-174286710 AGCAAAGTGGAGGAAGGGAGAGG + Intergenic
1006597201 6:35202147-35202169 AGCCACCTGCTGTATGGGAGAGG + Intergenic
1007368559 6:41411676-41411698 AGCCACGAGGGTCCAGGGAGTGG - Intergenic
1011810850 6:91130737-91130759 AGCCACACTGGGGAAGGGAGAGG - Intergenic
1015152425 6:130054714-130054736 AGCCACATGGAGTAAGGAAGAGG + Intronic
1017896537 6:158684958-158684980 GGCTATGTGGGGTAGGGGAGAGG - Intronic
1019122395 6:169813660-169813682 AGCCAAGTGGTGGAAGGTAGAGG + Intergenic
1021808186 7:24377286-24377308 AGCCACATGGGCAAAGGGAATGG + Intergenic
1022392826 7:29958255-29958277 AACCAGGTGGGGTTGGGGAGGGG + Intronic
1022471085 7:30682291-30682313 AGCCGCGTGCGGAGAGGGAGTGG + Intronic
1022538657 7:31114880-31114902 AGGGACCTGGGGTGAGGGAGAGG - Intergenic
1023375898 7:39554645-39554667 CTCCATGTGGGGAAAGGGAGTGG - Intergenic
1023562214 7:41488035-41488057 AGCCTCGTGGGGGGAGGGGGTGG + Intergenic
1024562169 7:50653770-50653792 AGCCACCTGGGGGATGGCAGGGG - Intronic
1025012315 7:55407324-55407346 TGCCCCTTGGGGTGAGGGAGAGG - Intronic
1026900395 7:74033794-74033816 AGCCCCGTGGGGCATGGGCGGGG - Intronic
1033497674 7:141916097-141916119 GGCCACGTGGAATCAGGGAGAGG + Intronic
1034435836 7:151062452-151062474 GGCCACGTGGGGGCAGGGAGGGG - Intronic
1037598569 8:20374528-20374550 AGCCCTGTGGGGTTAGTGAGGGG - Intergenic
1037926620 8:22848426-22848448 AGCCAAGGGGGATAGGGGAGAGG + Intronic
1039407899 8:37328470-37328492 AGCCTGGTGGGGGAAGGGAGAGG + Intergenic
1045348635 8:101317477-101317499 TGCCACGTGGGGCAAGGGCTAGG - Intergenic
1046668565 8:117033015-117033037 AGCCACGTGAAGGAAGGGAGTGG + Intronic
1049383926 8:142331432-142331454 AGCAGCATGGGGTCAGGGAGAGG + Intronic
1050113383 9:2239792-2239814 AGCCATGTGGAGTCAGAGAGGGG + Intergenic
1050280287 9:4043383-4043405 AGGCAGGTGGGGTGAGGGTGGGG + Intronic
1053006806 9:34610422-34610444 AGCCCCCCGGGGTAAGGGCGGGG + Intergenic
1053143651 9:35697605-35697627 AGGCACTTGGGGTTGGGGAGGGG + Exonic
1053354951 9:37437665-37437687 ATCCACCTGGGGGCAGGGAGGGG - Intergenic
1054454850 9:65424550-65424572 AGCCACGTGGGGTGAGGCCGTGG + Intergenic
1057391367 9:94643860-94643882 AGCCAAGTGGTGTATGTGAGAGG + Intergenic
1058493664 9:105530287-105530309 AGGGAAGTGGGGTGAGGGAGGGG + Intronic
1062277499 9:135737742-135737764 AGGTAGGAGGGGTAAGGGAGAGG - Intronic
1062547676 9:137070913-137070935 AGCCTCGTGGGGTAAGAATGGGG + Intergenic
1189195931 X:39152388-39152410 AGCCAGGTGGGGGCAGAGAGGGG - Intergenic
1189425813 X:40898837-40898859 AGTCATGTGGAGTCAGGGAGGGG - Intergenic
1190337005 X:49268854-49268876 AGTCACGGAGGGTTAGGGAGAGG + Intergenic
1192831488 X:74755157-74755179 AGCCAAGAGAGGTAAGGAAGTGG - Intronic
1195312225 X:103642947-103642969 AGCTACCTGAGGTAGGGGAGGGG - Intergenic
1196747671 X:119086175-119086197 ATCCACATGGTGTTAGGGAGGGG + Intronic
1196798814 X:119523959-119523981 GGCCCCATGGGGAAAGGGAGAGG + Intergenic
1198828326 X:140721666-140721688 CGCCATGTGGTGTAAGGCAGGGG - Intergenic
1199014944 X:142804376-142804398 CACCACGTGGGGTCAGGGATAGG + Intergenic